Incidental Mutation 'R0726:Usp28'
ID63768
Institutional Source Beutler Lab
Gene Symbol Usp28
Ensembl Gene ENSMUSG00000032267
Gene Nameubiquitin specific peptidase 28
Synonyms9830148O20Rik
MMRRC Submission 038908-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0726 (G1)
Quality Score162
Status Validated
Chromosome9
Chromosomal Location48985375-49042517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 49003869 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 115 (R115C)
Ref Sequence ENSEMBL: ENSMUSP00000150005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047349] [ENSMUST00000213874] [ENSMUST00000215788]
Predicted Effect probably damaging
Transcript: ENSMUST00000047349
AA Change: R141C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047467
Gene: ENSMUSG00000032267
AA Change: R141C

DomainStartEndE-ValueType
UIM 97 116 3.1e-3 SMART
Pfam:UCH 161 652 5.4e-52 PFAM
Pfam:UCH_1 162 626 2e-11 PFAM
low complexity region 695 705 N/A INTRINSIC
low complexity region 713 730 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000213874
AA Change: R141C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215788
AA Change: R115C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216607
Meta Mutation Damage Score 0.39 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.1%
  • 20x: 89.2%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a deubiquitinase involved in the DNA damage pathway and DNA damage-induced apoptosis. Overexpression of this gene is seen in several cancers. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit slightly decreased spleen weight and splenocyte number but show neither major signaling defects in DNA damage response nor developmental defects indicative of impaired double-strand break metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg12 T C 15: 88,806,647 Y256C probably damaging Het
Alox15 T A 11: 70,350,195 D160V probably damaging Het
Aox2 T C 1: 58,334,782 probably benign Het
Bbs9 G T 9: 22,793,823 A729S probably damaging Het
Bmp2k T A 5: 97,087,494 probably benign Het
Braf C T 6: 39,662,148 R223Q possibly damaging Het
Cd101 A T 3: 101,020,622 S48T possibly damaging Het
Cdh9 T G 15: 16,831,044 D322E probably benign Het
Col28a1 C T 6: 8,014,495 probably null Het
Cpxm1 G A 2: 130,390,939 R712W probably damaging Het
Csnk1g1 T C 9: 66,032,355 probably benign Het
Cyp2d37-ps A C 15: 82,690,449 noncoding transcript Het
Cyth3 T C 5: 143,692,642 V115A probably benign Het
Dnah9 C T 11: 65,965,681 V2885M probably damaging Het
Dock9 G T 14: 121,651,768 Y326* probably null Het
Espl1 T C 15: 102,322,598 I1844T probably benign Het
Fam105a A T 15: 27,656,947 I338N probably damaging Het
Fam20a T A 11: 109,677,194 N357Y probably damaging Het
Fancc C A 13: 63,323,411 R385L probably benign Het
Foxe3 A T 4: 114,925,250 L255H unknown Het
Frem2 T C 3: 53,519,626 D2967G possibly damaging Het
Gabra6 T G 11: 42,315,127 T301P probably damaging Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gm498 A G 7: 143,871,761 D49G probably damaging Het
Grm4 T A 17: 27,438,438 probably benign Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Kcnj9 G A 1: 172,325,921 S212F probably damaging Het
Kif15 C A 9: 122,959,928 H62N probably benign Het
Kptn A G 7: 16,120,722 D106G probably damaging Het
Krtap13-1 T A 16: 88,729,304 S139T probably damaging Het
Lepr C A 4: 101,764,934 N354K probably benign Het
Lypd3 G T 7: 24,638,544 E112* probably null Het
Med13l A T 5: 118,748,684 N1550I probably damaging Het
Mettl2 C T 11: 105,126,844 P60L probably benign Het
Muc4 A G 16: 32,769,827 E850G probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nek1 A G 8: 61,089,592 R739G probably damaging Het
Nipbl A T 15: 8,351,555 D584E probably benign Het
Nkain3 C T 4: 20,158,388 V162M possibly damaging Het
Nmrk1 T C 19: 18,641,480 probably benign Het
Nsd2 T C 5: 33,861,028 probably benign Het
Olfr1198 A T 2: 88,746,008 N293K probably benign Het
Olfr1270 T A 2: 90,149,283 H241L probably damaging Het
Olfr133 T C 17: 38,148,624 F12S probably damaging Het
Olfr1449 T A 19: 12,935,605 V289D probably damaging Het
Olfr907 T A 9: 38,499,122 M151K possibly damaging Het
Phex T A X: 157,372,561 probably benign Het
Pip5k1b G T 19: 24,378,892 D227E probably damaging Het
Prdm13 A G 4: 21,683,914 I119T unknown Het
Rab19 G T 6: 39,383,959 V14L probably benign Het
Rasa3 A G 8: 13,580,118 probably benign Het
Rgsl1 C T 1: 153,802,328 S118N probably damaging Het
Rif1 C T 2: 52,110,353 T1273M possibly damaging Het
Scn8a A G 15: 100,972,830 N254S probably damaging Het
Sema6a T C 18: 47,291,981 T188A probably damaging Het
Sh3pxd2a C T 19: 47,268,762 E506K probably damaging Het
Smarca2 A T 19: 26,698,403 K1014N probably damaging Het
Smarca4 T G 9: 21,700,139 probably null Het
Sntb1 T C 15: 55,676,356 R361G probably benign Het
Soga1 G T 2: 157,060,262 R278S probably damaging Het
Stx5a T A 19: 8,754,911 I208N probably damaging Het
Tas2r102 T A 6: 132,762,452 W108R probably damaging Het
Tcl1 A G 12: 105,218,670 Y94H probably damaging Het
Tenm3 T A 8: 48,236,594 Y1986F probably damaging Het
Tet2 G A 3: 133,468,184 P1439L probably benign Het
Tiam2 T C 17: 3,512,833 probably benign Het
Ubap2l G A 3: 90,021,246 T526M probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uhrf1bp1 T C 17: 27,885,489 V503A possibly damaging Het
Ushbp1 T A 8: 71,388,747 probably benign Het
Vldlr A T 19: 27,238,386 D261V probably damaging Het
Vmn2r5 C T 3: 64,503,765 D461N probably benign Het
Vmn2r86 A T 10: 130,446,396 F784I probably damaging Het
Zfp59 A T 7: 27,854,088 I322F probably damaging Het
Zfp607a A T 7: 27,879,149 H548L probably benign Het
Zfp626 G A 7: 27,818,623 C343Y probably damaging Het
Other mutations in Usp28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Usp28 APN 9 49028163 missense probably benign 0.01
IGL01105:Usp28 APN 9 49010250 missense probably damaging 1.00
IGL01124:Usp28 APN 9 49037213 missense probably damaging 1.00
IGL01304:Usp28 APN 9 49026819 missense probably damaging 0.99
IGL01527:Usp28 APN 9 49025873 missense probably benign 0.02
IGL01859:Usp28 APN 9 49024021 nonsense probably null
IGL01860:Usp28 APN 9 49032243 nonsense probably null
IGL02047:Usp28 APN 9 49035641 missense probably damaging 0.99
IGL02188:Usp28 APN 9 49024009 missense probably benign 0.00
IGL02267:Usp28 APN 9 49023965 missense probably damaging 1.00
IGL02472:Usp28 APN 9 49037769 missense possibly damaging 0.95
IGL02675:Usp28 APN 9 49039091 missense possibly damaging 0.81
IGL02982:Usp28 APN 9 49018439 missense probably benign 0.00
IGL03105:Usp28 APN 9 49039055 missense probably damaging 0.99
R0100:Usp28 UTSW 9 49035932 missense probably damaging 1.00
R0114:Usp28 UTSW 9 49039023 missense probably benign 0.00
R0196:Usp28 UTSW 9 49028278 missense probably damaging 0.96
R0206:Usp28 UTSW 9 49028269 missense probably damaging 1.00
R0349:Usp28 UTSW 9 49010281 nonsense probably null
R0379:Usp28 UTSW 9 49024067 missense possibly damaging 0.58
R0454:Usp28 UTSW 9 49039101 missense possibly damaging 0.94
R0479:Usp28 UTSW 9 49037213 missense probably damaging 1.00
R0540:Usp28 UTSW 9 49024060 missense probably benign
R0835:Usp28 UTSW 9 49001524 missense probably damaging 1.00
R0928:Usp28 UTSW 9 49030891 missense possibly damaging 0.60
R1271:Usp28 UTSW 9 49035961 critical splice donor site probably null
R1534:Usp28 UTSW 9 48985506 missense possibly damaging 0.92
R1539:Usp28 UTSW 9 49037796 missense probably benign 0.07
R1687:Usp28 UTSW 9 49024017 missense probably benign 0.00
R1867:Usp28 UTSW 9 49009194 missense probably benign 0.00
R1868:Usp28 UTSW 9 49016707 missense probably damaging 1.00
R1884:Usp28 UTSW 9 49035947 missense probably damaging 1.00
R2029:Usp28 UTSW 9 48985503 missense probably benign 0.22
R2046:Usp28 UTSW 9 49039075 missense probably damaging 1.00
R2379:Usp28 UTSW 9 49003095 missense probably null 0.94
R2404:Usp28 UTSW 9 49037258 critical splice donor site probably null
R3196:Usp28 UTSW 9 49025825 missense probably benign 0.03
R3831:Usp28 UTSW 9 49035638 missense probably benign 0.00
R3922:Usp28 UTSW 9 49030923 critical splice donor site probably null
R3924:Usp28 UTSW 9 49030923 critical splice donor site probably null
R3926:Usp28 UTSW 9 49030923 critical splice donor site probably null
R3943:Usp28 UTSW 9 49000366 missense probably benign 0.12
R4834:Usp28 UTSW 9 49001536 missense probably damaging 1.00
R5041:Usp28 UTSW 9 49037773 missense probably benign
R5186:Usp28 UTSW 9 49010250 missense probably damaging 1.00
R5308:Usp28 UTSW 9 49037201 missense probably damaging 1.00
R5870:Usp28 UTSW 9 49025985 nonsense probably null
R6838:Usp28 UTSW 9 49000430 critical splice donor site probably null
R6959:Usp28 UTSW 9 49001542 missense probably damaging 1.00
R7058:Usp28 UTSW 9 49039156 missense probably damaging 1.00
R7348:Usp28 UTSW 9 49030877 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GCCCACGTACCTGATAAGTACAAGC -3'
(R):5'- CCCTACTCCAGACTACCCTGAATGG -3'

Sequencing Primer
(F):5'- CGTACCTGATAAGTACAAGCTCTTC -3'
(R):5'- GAATGGTATTCATTAACTGCTGACCC -3'
Posted On2013-07-30