Incidental Mutation 'R0719:Or1ad6'
ID 63796
Institutional Source Beutler Lab
Gene Symbol Or1ad6
Ensembl Gene ENSMUSG00000050343
Gene Name olfactory receptor family 1 subfamily AD member 6
Synonyms Olfr1378, GA_x6K02T2QP88-4469162-4468215, MOR129-2
MMRRC Submission 038901-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R0719 (G1)
Quality Score 203
Status Not validated
Chromosome 11
Chromosomal Location 50859847-50860794 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 50860761 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 305 (C305*)
Ref Sequence ENSEMBL: ENSMUSP00000149432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052285] [ENSMUST00000213259]
AlphaFold Q8VGH0
Predicted Effect probably null
Transcript: ENSMUST00000052285
AA Change: C305*
SMART Domains Protein: ENSMUSP00000058119
Gene: ENSMUSG00000050343
AA Change: C305*

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5.1e-54 PFAM
Pfam:7tm_1 41 289 1.4e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213259
AA Change: C305*
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 10 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Clk4 T A 11: 51,166,320 (GRCm39) Y67* probably null Het
Eif1 T A 11: 100,211,856 (GRCm39) I93K possibly damaging Het
Glmp G T 3: 88,233,452 (GRCm39) E136* probably null Het
Hgs T C 11: 120,362,431 (GRCm39) probably null Het
Iqcg T C 16: 32,861,215 (GRCm39) D167G probably benign Het
Pik3c2g G A 6: 139,606,723 (GRCm39) E257K probably damaging Het
Ppp1r9b T A 11: 94,892,661 (GRCm39) probably null Het
Rock1 T C 18: 10,099,328 (GRCm39) H691R probably damaging Het
Sgce T A 6: 4,689,753 (GRCm39) H360L probably damaging Het
Susd1 T A 4: 59,329,506 (GRCm39) N641I possibly damaging Het
Other mutations in Or1ad6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Or1ad6 APN 11 50,859,946 (GRCm39) missense probably benign 0.00
PIT4243001:Or1ad6 UTSW 11 50,860,379 (GRCm39) missense probably damaging 1.00
R0540:Or1ad6 UTSW 11 50,860,670 (GRCm39) missense possibly damaging 0.96
R0607:Or1ad6 UTSW 11 50,860,670 (GRCm39) missense possibly damaging 0.96
R0699:Or1ad6 UTSW 11 50,860,645 (GRCm39) missense probably damaging 1.00
R2117:Or1ad6 UTSW 11 50,860,147 (GRCm39) missense probably damaging 0.98
R2263:Or1ad6 UTSW 11 50,860,696 (GRCm39) missense possibly damaging 0.75
R3402:Or1ad6 UTSW 11 50,859,895 (GRCm39) missense probably benign
R3767:Or1ad6 UTSW 11 50,860,385 (GRCm39) missense probably damaging 1.00
R3768:Or1ad6 UTSW 11 50,860,385 (GRCm39) missense probably damaging 1.00
R3769:Or1ad6 UTSW 11 50,860,385 (GRCm39) missense probably damaging 1.00
R4293:Or1ad6 UTSW 11 50,860,253 (GRCm39) missense probably damaging 1.00
R4409:Or1ad6 UTSW 11 50,860,223 (GRCm39) missense probably damaging 1.00
R4446:Or1ad6 UTSW 11 50,860,690 (GRCm39) missense probably damaging 1.00
R4731:Or1ad6 UTSW 11 50,860,093 (GRCm39) missense possibly damaging 0.78
R4732:Or1ad6 UTSW 11 50,860,093 (GRCm39) missense possibly damaging 0.78
R4733:Or1ad6 UTSW 11 50,860,093 (GRCm39) missense possibly damaging 0.78
R5437:Or1ad6 UTSW 11 50,859,935 (GRCm39) missense probably benign 0.02
R6085:Or1ad6 UTSW 11 50,859,950 (GRCm39) missense
R6648:Or1ad6 UTSW 11 50,860,000 (GRCm39) missense probably damaging 1.00
R7419:Or1ad6 UTSW 11 50,860,152 (GRCm39) nonsense probably null
R7686:Or1ad6 UTSW 11 50,860,582 (GRCm39) missense possibly damaging 0.92
R8440:Or1ad6 UTSW 11 50,860,024 (GRCm39) missense probably damaging 1.00
R9408:Or1ad6 UTSW 11 50,860,613 (GRCm39) missense probably damaging 1.00
R9451:Or1ad6 UTSW 11 50,859,950 (GRCm39) missense
R9663:Or1ad6 UTSW 11 50,860,165 (GRCm39) missense probably benign 0.15
R9711:Or1ad6 UTSW 11 50,860,316 (GRCm39) missense probably damaging 1.00
X0011:Or1ad6 UTSW 11 50,860,481 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCTCCAATGTGCTGAAGTTCCCATC -3'
(R):5'- TGCTAGGCACAACCATGCGAAG -3'

Sequencing Primer
(F):5'- AAGGAAAGCCCTGTCTACTTGTG -3'
(R):5'- TGAAGTTAGCAAACATGCTCAC -3'
Posted On 2013-07-30