Incidental Mutation 'R0697:A1cf'
ID 63908
Institutional Source Beutler Lab
Gene Symbol A1cf
Ensembl Gene ENSMUSG00000052595
Gene Name APOBEC1 complementation factor
Synonyms 1810073H04Rik, apobec-1 complementation factor, ACF
MMRRC Submission 038881-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R0697 (G1)
Quality Score 100
Status Not validated
Chromosome 19
Chromosomal Location 31846164-31926395 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 31888567 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 99 (A99E)
Ref Sequence ENSEMBL: ENSMUSP00000153465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075838] [ENSMUST00000224304] [ENSMUST00000224400] [ENSMUST00000224564]
AlphaFold Q5YD48
Predicted Effect probably damaging
Transcript: ENSMUST00000075838
AA Change: A99E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075235
Gene: ENSMUSG00000052595
AA Change: A99E

DomainStartEndE-ValueType
RRM 57 130 2.13e-18 SMART
RRM 137 214 1.59e-8 SMART
RRM 232 299 1.36e-16 SMART
low complexity region 386 411 N/A INTRINSIC
Pfam:DND1_DSRM 445 523 1.6e-30 PFAM
low complexity region 526 542 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000224304
AA Change: A99E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224400
AA Change: A15E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000224564
AA Change: A99E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225165
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian apolipoprotein B mRNA undergoes site-specific C to U deamination, which is mediated by a multi-component enzyme complex containing a minimal core composed of APOBEC-1 and a complementation factor encoded by this gene. The gene product has three non-identical RNA recognition motifs and belongs to the hnRNP R family of RNA-binding proteins. It has been proposed that this complementation factor functions as an RNA-binding subunit and docks APOBEC-1 to deaminate the upstream cytidine. Studies suggest that the protein may also be involved in other RNA editing or RNA processing events. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Embryos homozygous for a targeted deletion of this gene are detectable only until the blastocyst stage (E3.5) and isolated mutant blastocysts fail to proliferate in vitro. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aig1 T C 10: 13,705,069 (GRCm39) N72S probably benign Het
Atad2 T C 15: 57,968,939 (GRCm39) I857M possibly damaging Het
Ceacam15 A C 7: 16,407,445 (GRCm39) L24* probably null Het
Cpsf2 A G 12: 101,949,443 (GRCm39) H53R probably benign Het
Crh C A 3: 19,748,241 (GRCm39) G134C probably damaging Het
Cyp2g1 A T 7: 26,514,152 (GRCm39) K253* probably null Het
Dna2 T C 10: 62,785,120 (GRCm39) V79A probably benign Het
Dsc2 A G 18: 20,174,509 (GRCm39) V549A probably damaging Het
Etl4 G T 2: 20,748,672 (GRCm39) V135F probably damaging Het
Frk A G 10: 34,483,833 (GRCm39) H398R probably benign Het
Gfra1 A C 19: 58,258,555 (GRCm39) S271A probably benign Het
Htr1b T C 9: 81,513,516 (GRCm39) I364V possibly damaging Het
Kcnh5 A T 12: 75,023,305 (GRCm39) C588S possibly damaging Het
Kif13a G A 13: 47,001,813 (GRCm39) T70I probably benign Het
Klra6 T C 6: 129,993,687 (GRCm39) I195V probably benign Het
Nras T C 3: 102,967,616 (GRCm39) Y71H possibly damaging Het
Sirt5 T C 13: 43,539,052 (GRCm39) F274L probably damaging Het
Synj1 T C 16: 90,757,503 (GRCm39) T882A probably benign Het
Vmn1r84 A T 7: 12,096,690 (GRCm39) M1K probably null Het
Zfhx4 A T 3: 5,466,793 (GRCm39) E2317V probably damaging Het
Zfp345 A T 2: 150,314,829 (GRCm39) I236K probably benign Het
Other mutations in A1cf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:A1cf APN 19 31,898,351 (GRCm39) missense possibly damaging 0.90
IGL01411:A1cf APN 19 31,888,629 (GRCm39) missense possibly damaging 0.94
IGL01445:A1cf APN 19 31,923,198 (GRCm39) missense probably benign 0.32
IGL02165:A1cf APN 19 31,904,586 (GRCm39) missense possibly damaging 0.92
IGL02543:A1cf APN 19 31,895,495 (GRCm39) missense probably damaging 0.97
IGL02651:A1cf APN 19 31,909,906 (GRCm39) missense probably benign 0.25
IGL02904:A1cf APN 19 31,912,206 (GRCm39) missense probably damaging 1.00
Haywire UTSW 19 31,895,524 (GRCm39) critical splice donor site probably null
R0281:A1cf UTSW 19 31,923,214 (GRCm39) missense probably benign 0.09
R0349:A1cf UTSW 19 31,910,062 (GRCm39) missense possibly damaging 0.62
R0662:A1cf UTSW 19 31,898,338 (GRCm39) missense probably benign 0.00
R1055:A1cf UTSW 19 31,909,919 (GRCm39) missense probably benign 0.05
R1125:A1cf UTSW 19 31,898,378 (GRCm39) missense probably benign 0.00
R1448:A1cf UTSW 19 31,886,196 (GRCm39) missense possibly damaging 0.88
R1554:A1cf UTSW 19 31,886,302 (GRCm39) missense possibly damaging 0.66
R1616:A1cf UTSW 19 31,912,175 (GRCm39) missense probably damaging 0.98
R1660:A1cf UTSW 19 31,870,507 (GRCm39) nonsense probably null
R1719:A1cf UTSW 19 31,904,526 (GRCm39) missense probably damaging 1.00
R2338:A1cf UTSW 19 31,909,945 (GRCm39) missense probably benign
R2435:A1cf UTSW 19 31,898,294 (GRCm39) missense probably benign 0.02
R2890:A1cf UTSW 19 31,895,417 (GRCm39) missense probably benign 0.05
R3688:A1cf UTSW 19 31,888,569 (GRCm39) missense probably damaging 1.00
R4007:A1cf UTSW 19 31,895,524 (GRCm39) critical splice donor site probably null
R4208:A1cf UTSW 19 31,910,060 (GRCm39) missense probably benign 0.00
R4448:A1cf UTSW 19 31,923,262 (GRCm39) missense probably benign
R5072:A1cf UTSW 19 31,895,385 (GRCm39) missense probably benign 0.18
R5491:A1cf UTSW 19 31,895,462 (GRCm39) missense possibly damaging 0.57
R5636:A1cf UTSW 19 31,922,382 (GRCm39) nonsense probably null
R5932:A1cf UTSW 19 31,870,518 (GRCm39) missense possibly damaging 0.68
R7066:A1cf UTSW 19 31,904,514 (GRCm39) missense probably damaging 0.99
R7211:A1cf UTSW 19 31,904,541 (GRCm39) missense probably benign 0.23
R7413:A1cf UTSW 19 31,895,524 (GRCm39) critical splice donor site probably null
R7545:A1cf UTSW 19 31,912,190 (GRCm39) missense possibly damaging 0.80
R8020:A1cf UTSW 19 31,870,594 (GRCm39) missense probably benign 0.01
R8344:A1cf UTSW 19 31,888,519 (GRCm39) missense possibly damaging 0.77
R8497:A1cf UTSW 19 31,923,250 (GRCm39) missense probably benign
R8989:A1cf UTSW 19 31,904,556 (GRCm39) missense possibly damaging 0.56
R9327:A1cf UTSW 19 31,895,499 (GRCm39) missense probably benign 0.12
R9436:A1cf UTSW 19 31,909,975 (GRCm39) missense probably benign
Z1176:A1cf UTSW 19 31,895,417 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CATGGATACAAATGCCAAACATGGCAG -3'
(R):5'- TCAAGTAGCATTCTCTCCGCACAATC -3'

Sequencing Primer
(F):5'- tgtttctgtgtgtgtgtgtttc -3'
(R):5'- ACCAGACCGTTTTTAACGAAG -3'
Posted On 2013-07-30