Incidental Mutation 'R0005:Col11a2'
ID63943
Institutional Source Beutler Lab
Gene Symbol Col11a2
Ensembl Gene ENSMUSG00000024330
Gene Namecollagen, type XI, alpha 2
Synonyms
MMRRC Submission 038301-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.403) question?
Stock #R0005 (G1)
Quality Score118
Status Validated
Chromosome17
Chromosomal Location34039437-34066685 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 34062879 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087497] [ENSMUST00000114252] [ENSMUST00000114255] [ENSMUST00000143354]
Predicted Effect unknown
Transcript: ENSMUST00000087497
AA Change: A1320V
SMART Domains Protein: ENSMUSP00000084772
Gene: ENSMUSG00000024330
AA Change: A1320V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
Pfam:Collagen 306 364 2.2e-9 PFAM
Pfam:Collagen 399 460 1e-10 PFAM
Pfam:Collagen 437 520 1.2e-7 PFAM
Pfam:Collagen 479 553 5.7e-9 PFAM
Pfam:Collagen 506 579 1.6e-8 PFAM
internal_repeat_4 584 614 3.98e-5 PROSPERO
internal_repeat_2 584 669 5.49e-20 PROSPERO
internal_repeat_1 587 740 2.58e-22 PROSPERO
Pfam:Collagen 743 814 1.5e-8 PFAM
Pfam:Collagen 767 839 4.8e-7 PFAM
low complexity region 854 872 N/A INTRINSIC
Pfam:Collagen 881 946 4.5e-8 PFAM
Pfam:Collagen 905 976 2e-7 PFAM
Pfam:Collagen 933 1002 2.7e-8 PFAM
low complexity region 1013 1047 N/A INTRINSIC
low complexity region 1064 1112 N/A INTRINSIC
low complexity region 1121 1199 N/A INTRINSIC
low complexity region 1216 1232 N/A INTRINSIC
low complexity region 1289 1320 N/A INTRINSIC
Pfam:Collagen 1358 1417 1.7e-8 PFAM
COLFI 1454 1649 4.42e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000114252
AA Change: A1325V
SMART Domains Protein: ENSMUSP00000109890
Gene: ENSMUSG00000024330
AA Change: A1325V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
Pfam:Collagen 311 369 2.3e-9 PFAM
Pfam:Collagen 404 465 1.1e-10 PFAM
Pfam:Collagen 442 525 1.3e-7 PFAM
Pfam:Collagen 484 558 6.4e-9 PFAM
Pfam:Collagen 511 584 1.7e-8 PFAM
internal_repeat_4 589 619 3.69e-5 PROSPERO
internal_repeat_2 589 674 4.46e-20 PROSPERO
internal_repeat_1 592 745 2.05e-22 PROSPERO
internal_repeat_3 636 752 7.84e-10 PROSPERO
Pfam:Collagen 772 844 5.5e-7 PFAM
Pfam:Collagen 800 869 1.9e-8 PFAM
Pfam:Collagen 886 951 5e-8 PFAM
Pfam:Collagen 910 981 2.2e-7 PFAM
Pfam:Collagen 934 1007 6.9e-7 PFAM
low complexity region 1018 1052 N/A INTRINSIC
low complexity region 1069 1117 N/A INTRINSIC
low complexity region 1126 1204 N/A INTRINSIC
low complexity region 1221 1237 N/A INTRINSIC
low complexity region 1294 1325 N/A INTRINSIC
Pfam:Collagen 1363 1422 1.9e-8 PFAM
COLFI 1459 1654 4.42e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000114255
AA Change: A1359V
SMART Domains Protein: ENSMUSP00000109893
Gene: ENSMUSG00000024330
AA Change: A1359V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
low complexity region 257 268 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
Pfam:Collagen 345 403 2.1e-9 PFAM
Pfam:Collagen 438 499 1.1e-10 PFAM
Pfam:Collagen 521 593 2.2e-8 PFAM
Pfam:Collagen 545 613 9.1e-10 PFAM
internal_repeat_4 623 653 2.83e-5 PROSPERO
internal_repeat_2 623 708 2.11e-20 PROSPERO
internal_repeat_1 626 779 9e-23 PROSPERO
internal_repeat_3 670 786 5.16e-10 PROSPERO
low complexity region 788 819 N/A INTRINSIC
low complexity region 830 857 N/A INTRINSIC
low complexity region 866 887 N/A INTRINSIC
low complexity region 893 911 N/A INTRINSIC
low complexity region 919 935 N/A INTRINSIC
Pfam:Collagen 973 1041 2.9e-8 PFAM
low complexity region 1052 1086 N/A INTRINSIC
low complexity region 1103 1151 N/A INTRINSIC
low complexity region 1160 1238 N/A INTRINSIC
low complexity region 1255 1271 N/A INTRINSIC
low complexity region 1328 1359 N/A INTRINSIC
Pfam:Collagen 1394 1456 1.5e-8 PFAM
COLFI 1493 1688 4.42e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143354
SMART Domains Protein: ENSMUSP00000115026
Gene: ENSMUSG00000024330

DomainStartEndE-ValueType
Pfam:Collagen 3 56 4.7e-9 PFAM
Pfam:Collagen 91 152 1.7e-9 PFAM
internal_repeat_1 158 301 3.7e-11 PROSPERO
internal_repeat_2 276 321 1.18e-9 PROSPERO
internal_repeat_4 291 306 1.06e-5 PROSPERO
internal_repeat_3 303 353 1.87e-6 PROSPERO
internal_repeat_2 315 360 1.18e-9 PROSPERO
internal_repeat_1 323 439 3.7e-11 PROSPERO
low complexity region 441 472 N/A INTRINSIC
low complexity region 483 510 N/A INTRINSIC
low complexity region 519 540 N/A INTRINSIC
low complexity region 546 564 N/A INTRINSIC
low complexity region 572 588 N/A INTRINSIC
Pfam:Collagen 603 673 6.6e-6 PFAM
Pfam:Collagen 627 694 5.4e-7 PFAM
Pfam:Collagen 660 734 3.2e-7 PFAM
Pfam:Collagen 711 770 1.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144927
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: This gene encodes the alpha-2 subunit of type XI collagen, one of the low abundance fibrillar collagens found in cartilage. The encoded protein, in association with other collagen subunits, forms a heterotrimeric type XI procollagen that may undergo proteolytic processing similar to the alpha-1 subunit. Mice lacking the encoded protein exhibit a mild phenotype similar to nonocular Stickler syndrome, otospondylomegaepiphyseal dysplasia (OSMED) as well as a nonsyndromic form of deafness called DFNA13. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant animals exhibit reduced body size, short snout, a slightly bulged forehead, deafness, and disorganization of chondrocytes in the growth plate of long bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn2l A G 7: 126,498,274 F201L probably damaging Het
BC037034 T C 5: 138,262,654 probably null Het
Camsap3 T A 8: 3,604,288 F653I probably damaging Het
Col27a1 A G 4: 63,225,400 T442A probably benign Het
Cpsf1 A G 15: 76,600,680 probably null Het
Enpp4 T C 17: 44,102,175 N156S probably benign Het
Fat3 T A 9: 15,962,866 N3485I probably damaging Het
Gabra2 C T 5: 70,973,436 V350I probably benign Het
Gm8909 G T 17: 36,162,192 probably benign Het
Hivep2 A G 10: 14,128,749 T364A probably damaging Het
Kif1b A T 4: 149,181,927 V402E probably damaging Het
Lamc3 A G 2: 31,922,428 D959G probably benign Het
Mag T A 7: 30,908,354 probably benign Het
Map3k1 A G 13: 111,755,704 F1006L probably benign Het
Mapre2 G A 18: 23,853,693 G54D probably damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Myadm C T 7: 3,297,564 Q281* probably null Het
Mylk3 A T 8: 85,327,203 V625D possibly damaging Het
Nlrp9a T C 7: 26,573,788 probably benign Het
Olfr974 A G 9: 39,942,956 D232G probably benign Het
Plcz1 T A 6: 140,040,564 probably benign Het
Plekhg5 TCCCCC TCC 4: 152,112,651 probably benign Het
Plekhh2 A C 17: 84,586,433 D892A probably benign Het
Ppih A G 4: 119,318,601 probably benign Het
Pramef12 G T 4: 144,395,853 F40L probably damaging Het
Rtn4ip1 A T 10: 43,932,478 M84L probably benign Het
Slc35f4 G A 14: 49,322,486 probably benign Het
Spocd1 G T 4: 129,956,778 D866Y possibly damaging Het
Stxbp4 C T 11: 90,548,917 R365Q possibly damaging Het
Tmed4 C T 11: 6,271,781 R185H probably damaging Het
Tmem2 A G 19: 21,812,220 T595A probably damaging Het
Tnfsf9 T C 17: 57,107,236 V221A possibly damaging Het
Vsx2 C A 12: 84,570,241 P100Q possibly damaging Het
Wdr48 T A 9: 119,909,434 D53E probably benign Het
Zfp335 T A 2: 164,909,302 S115C possibly damaging Het
Zfp608 G A 18: 54,895,520 P1274S possibly damaging Het
Other mutations in Col11a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01723:Col11a2 APN 17 34061280 unclassified probably benign
IGL01839:Col11a2 APN 17 34064082 unclassified probably benign
IGL02429:Col11a2 APN 17 34042292 missense probably damaging 1.00
IGL02491:Col11a2 APN 17 34064207 unclassified probably benign
R0001:Col11a2 UTSW 17 34061612 missense probably benign 0.00
R0099:Col11a2 UTSW 17 34049674 missense probably damaging 0.99
R0106:Col11a2 UTSW 17 34057275 missense probably damaging 0.99
R0243:Col11a2 UTSW 17 34062546 unclassified probably benign
R0254:Col11a2 UTSW 17 34064803 unclassified probably benign
R0352:Col11a2 UTSW 17 34042527 missense probably benign 0.43
R0362:Col11a2 UTSW 17 34062446 splice site probably null
R0491:Col11a2 UTSW 17 34042212 missense probably null 0.00
R0531:Col11a2 UTSW 17 34058377 splice site probably benign
R0538:Col11a2 UTSW 17 34051328 splice site probably benign
R0646:Col11a2 UTSW 17 34059348 critical splice donor site probably null
R0676:Col11a2 UTSW 17 34057275 missense probably damaging 0.99
R0919:Col11a2 UTSW 17 34059150 missense possibly damaging 0.93
R1522:Col11a2 UTSW 17 34055254 missense probably damaging 1.00
R1767:Col11a2 UTSW 17 34063895 unclassified probably benign
R1872:Col11a2 UTSW 17 34062555 unclassified probably benign
R1941:Col11a2 UTSW 17 34044951 missense probably benign 0.01
R1945:Col11a2 UTSW 17 34059168 missense probably damaging 1.00
R2101:Col11a2 UTSW 17 34052169 missense probably damaging 1.00
R2161:Col11a2 UTSW 17 34064797 unclassified probably benign
R2258:Col11a2 UTSW 17 34039677 missense probably benign
R2259:Col11a2 UTSW 17 34039677 missense probably benign
R2260:Col11a2 UTSW 17 34039677 missense probably benign
R2761:Col11a2 UTSW 17 34051026 missense probably damaging 1.00
R3114:Col11a2 UTSW 17 34046468 missense possibly damaging 0.69
R3824:Col11a2 UTSW 17 34054180 missense probably damaging 1.00
R3938:Col11a2 UTSW 17 34039625 unclassified probably benign
R4039:Col11a2 UTSW 17 34045774 missense probably benign 0.00
R4675:Col11a2 UTSW 17 34064293 critical splice donor site probably null
R4810:Col11a2 UTSW 17 34057112 missense probably damaging 0.99
R4824:Col11a2 UTSW 17 34050963 missense probably damaging 1.00
R4944:Col11a2 UTSW 17 34042190 missense possibly damaging 0.47
R5112:Col11a2 UTSW 17 34064088 unclassified probably benign
R5355:Col11a2 UTSW 17 34051801 missense probably benign 0.07
R5384:Col11a2 UTSW 17 34059174 critical splice donor site probably null
R5534:Col11a2 UTSW 17 34051024 missense probably damaging 0.99
R5860:Col11a2 UTSW 17 34064185 unclassified probably benign
R6252:Col11a2 UTSW 17 34042212 missense probably null 0.00
R6327:Col11a2 UTSW 17 34043317 missense probably benign 0.32
R6828:Col11a2 UTSW 17 34053633 splice site probably null
R6860:Col11a2 UTSW 17 34053598 missense probably damaging 1.00
R6873:Col11a2 UTSW 17 34065019 missense unknown
X0017:Col11a2 UTSW 17 34059985 critical splice donor site probably null
X0064:Col11a2 UTSW 17 34042247 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGTATCAACAATCCTCCCGACCCTG -3'
(R):5'- ACATCTCTGAGCCATGTCCTGTACC -3'

Sequencing Primer
(F):5'- CTATAGGGTCAGCAAGGCCG -3'
(R):5'- CAATCAGTCCGATGAGACCTG -3'
Posted On2013-07-30