Incidental Mutation 'R0691:Crybg3'
ID63972
Institutional Source Beutler Lab
Gene Symbol Crybg3
Ensembl Gene ENSMUSG00000022723
Gene Namebeta-gamma crystallin domain containing 3
Synonyms
MMRRC Submission 038876-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R0691 (G1)
Quality Score208
Status Validated
Chromosome16
Chromosomal Location59490775-59600979 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 59565211 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156047 (fasta)
Predicted Effect probably null
Transcript: ENSMUST00000172910
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,639,253 D865G possibly damaging Het
Acy1 A T 9: 106,435,871 probably null Het
Adcy4 A T 14: 55,772,647 probably benign Het
Anpep T G 7: 79,839,299 D347A probably damaging Het
Arhgap28 C T 17: 67,896,164 probably null Het
Ccdc32 A G 2: 119,027,129 probably benign Het
Cdc42bpa A G 1: 180,144,835 T1401A possibly damaging Het
Celsr2 A G 3: 108,412,623 Y958H probably damaging Het
Cenpe A G 3: 135,217,305 E137G probably damaging Het
Chd8 T C 14: 52,213,433 D1399G probably damaging Het
Cntn3 T C 6: 102,168,947 T978A possibly damaging Het
Col10a1 A G 10: 34,395,696 T555A possibly damaging Het
Cts7 A G 13: 61,355,734 F139L probably damaging Het
Dera T C 6: 137,796,747 probably benign Het
Dgka A G 10: 128,723,260 probably benign Het
Dhrs7 T A 12: 72,652,351 I286F probably damaging Het
Dtwd2 A G 18: 49,728,357 probably benign Het
Fam160b2 T C 14: 70,588,287 D351G probably damaging Het
Fermt1 A G 2: 132,906,733 S657P probably damaging Het
Flnb T C 14: 7,890,810 V564A probably benign Het
Garnl3 A G 2: 33,085,907 F16L probably damaging Het
Gck T C 11: 5,906,691 R191G probably damaging Het
Gucy1b1 A T 3: 82,045,634 probably benign Het
Ifna2 A C 4: 88,683,658 L41R probably damaging Het
Krt33a T G 11: 100,012,715 E197A probably damaging Het
Lce1e G A 3: 92,707,756 R95C unknown Het
Lct G T 1: 128,308,234 S345R probably benign Het
Lrp2 A T 2: 69,451,380 N3882K probably benign Het
Mcc G T 18: 44,445,860 T652K possibly damaging Het
Mier1 A G 4: 103,139,502 S109G probably benign Het
Nfat5 A G 8: 107,355,605 N469S probably damaging Het
Olfr382 C A 11: 73,516,844 M118I possibly damaging Het
Olfr807 G A 10: 129,755,402 T16I probably damaging Het
Piwil1 G T 5: 128,743,307 R256M probably null Het
Rgma T C 7: 73,409,412 V88A probably damaging Het
Sdk2 T C 11: 113,794,920 probably null Het
Sec22b A G 3: 97,912,674 E94G probably damaging Het
Snrnp70 T C 7: 45,387,245 R131G possibly damaging Het
Spata31d1a A G 13: 59,700,385 S1310P possibly damaging Het
Spint1 A G 2: 119,246,467 E344G probably damaging Het
Srrm1 G A 4: 135,324,991 Q141* probably null Het
Tecta A T 9: 42,384,341 L286Q probably damaging Het
Tep1 T A 14: 50,866,844 K198* probably null Het
Tk2 A G 8: 104,231,192 V174A probably benign Het
Txndc5 T C 13: 38,507,896 K165E probably damaging Het
Ubr4 G A 4: 139,423,906 R1884Q probably damaging Het
Vmn2r61 T C 7: 42,300,420 Y755H probably damaging Het
Xrn1 T A 9: 95,973,539 H296Q probably damaging Het
Zar1l A T 5: 150,512,942 V223D probably damaging Het
Other mutations in Crybg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Crybg3 APN 16 59530440 missense probably benign 0.15
IGL01305:Crybg3 APN 16 59529227 missense probably damaging 1.00
IGL01809:Crybg3 APN 16 59524853 critical splice donor site probably benign 0.00
IGL02247:Crybg3 APN 16 59503150 missense probably damaging 1.00
IGL02252:Crybg3 APN 16 59552524 splice site probably benign
IGL03036:Crybg3 APN 16 59555179 missense possibly damaging 0.68
IGL03202:Crybg3 APN 16 59494709 missense probably damaging 1.00
IGL03232:Crybg3 APN 16 59530368 missense probably damaging 1.00
ANU22:Crybg3 UTSW 16 59529227 missense probably damaging 1.00
R0052:Crybg3 UTSW 16 59565656 splice site probably benign
R0335:Crybg3 UTSW 16 59544140 missense probably damaging 1.00
R1511:Crybg3 UTSW 16 59554112 missense probably benign 0.01
R1579:Crybg3 UTSW 16 59530198 missense probably damaging 1.00
R1965:Crybg3 UTSW 16 59503237 missense probably damaging 1.00
R1982:Crybg3 UTSW 16 59544125 missense possibly damaging 0.85
R2225:Crybg3 UTSW 16 59554678 missense probably damaging 1.00
R4074:Crybg3 UTSW 16 59555757 unclassified probably null
R4210:Crybg3 UTSW 16 59544051 missense probably damaging 1.00
R4393:Crybg3 UTSW 16 59560095 unclassified probably benign
R4394:Crybg3 UTSW 16 59560095 unclassified probably benign
R4397:Crybg3 UTSW 16 59560095 unclassified probably benign
R4427:Crybg3 UTSW 16 59543199 missense probably damaging 1.00
R4578:Crybg3 UTSW 16 59530201 missense probably damaging 1.00
R4720:Crybg3 UTSW 16 59539817 missense probably damaging 1.00
R4917:Crybg3 UTSW 16 59530419 missense probably benign 0.14
R5007:Crybg3 UTSW 16 59558100 unclassified probably benign
R5020:Crybg3 UTSW 16 59554796 missense possibly damaging 0.55
R5155:Crybg3 UTSW 16 59524901 missense possibly damaging 0.91
R5306:Crybg3 UTSW 16 59559993 unclassified probably benign
R5342:Crybg3 UTSW 16 59522149 missense probably damaging 1.00
R5687:Crybg3 UTSW 16 59559166 missense probably benign 0.00
R5763:Crybg3 UTSW 16 59554610 missense possibly damaging 0.74
R5860:Crybg3 UTSW 16 59565269 missense probably damaging 1.00
R5950:Crybg3 UTSW 16 59493571 unclassified probably benign
R6007:Crybg3 UTSW 16 59554474 nonsense probably null
R6042:Crybg3 UTSW 16 59550475 missense possibly damaging 0.70
R6049:Crybg3 UTSW 16 59544054 missense probably benign 0.00
R6242:Crybg3 UTSW 16 59555690 missense probably benign
R6301:Crybg3 UTSW 16 59530338 missense probably damaging 1.00
R6408:Crybg3 UTSW 16 59495690 missense possibly damaging 0.71
R6724:Crybg3 UTSW 16 59544138 missense probably benign 0.13
R6745:Crybg3 UTSW 16 59552244 missense possibly damaging 0.93
R6777:Crybg3 UTSW 16 59558315 unclassified probably benign
R6843:Crybg3 UTSW 16 59559796 missense probably benign 0.22
R6914:Crybg3 UTSW 16 59539820 missense possibly damaging 0.89
R6942:Crybg3 UTSW 16 59539820 missense possibly damaging 0.89
R7033:Crybg3 UTSW 16 59554165 missense probably damaging 1.00
R7091:Crybg3 UTSW 16 59557168 missense not run
R7133:Crybg3 UTSW 16 59536804 missense not run
Predicted Primers PCR Primer
(F):5'- AATTAGGCACTCTGGCAGTGGCAC -3'
(R):5'- TGGACGATCTCCCAAAGCCAAAGG -3'

Sequencing Primer
(F):5'- CTGGCAGTGGCACTAGACTATTAC -3'
(R):5'- GTCTTCCTTCAAAGATGACCAGG -3'
Posted On2013-07-30