Incidental Mutation 'R0076:Ube3b'
ID63979
Institutional Source Beutler Lab
Gene Symbol Ube3b
Ensembl Gene ENSMUSG00000029577
Gene Nameubiquitin protein ligase E3B
Synonyms
MMRRC Submission 038363-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0076 (G1)
Quality Score83
Status Validated
Chromosome5
Chromosomal Location114380607-114421169 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 114408217 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000073652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]
Predicted Effect probably null
Transcript: ENSMUST00000074002
SMART Domains Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
low complexity region 470 488 N/A INTRINSIC
HECTc 697 1070 2.15e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130169
SMART Domains Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183408
Predicted Effect probably benign
Transcript: ENSMUST00000196651
SMART Domains Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
HECTc 122 495 1.1e-112 SMART
Meta Mutation Damage Score 0.702 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp A G 9: 104,324,218 probably benign Het
Ankrd17 T A 5: 90,244,406 K1693* probably null Het
Car10 G A 11: 93,490,597 E129K possibly damaging Het
Ccnd1 A C 7: 144,939,665 V10G probably benign Het
Cd19 T C 7: 126,410,862 D406G probably damaging Het
Col4a1 G A 8: 11,218,713 P1009L probably damaging Het
Col9a1 G A 1: 24,237,497 probably null Het
Crlf3 A T 11: 80,056,601 probably benign Het
Dock3 A C 9: 106,911,486 probably benign Het
Dus1l A T 11: 120,792,808 probably benign Het
Dvl2 G A 11: 70,008,100 E438K probably damaging Het
Eif3g A G 9: 20,897,753 F85S probably damaging Het
Fam234b A G 6: 135,227,226 M456V probably benign Het
Fbxo47 G A 11: 97,857,655 probably benign Het
Galntl5 A G 5: 25,186,072 probably null Het
Gm11437 T C 11: 84,148,636 T288A possibly damaging Het
Gm5546 T A 3: 104,353,132 noncoding transcript Het
Gmfb C A 14: 46,817,455 A11S probably benign Het
Hnrnpa3 G T 2: 75,661,696 R52L probably damaging Het
Ing3 T C 6: 21,952,171 M48T probably benign Het
Kmt2a A G 9: 44,830,059 probably benign Het
Maats1 G A 16: 38,302,684 Q661* probably null Het
Megf8 G A 7: 25,353,958 probably null Het
Pex3 A G 10: 13,535,594 V180A probably benign Het
Pou6f1 G A 15: 100,587,836 Q106* probably null Het
Ror2 T C 13: 53,113,074 M442V probably benign Het
Rspo1 G A 4: 124,991,397 R22Q probably benign Het
Sec1 A G 7: 45,678,891 V244A probably damaging Het
Serac1 A G 17: 6,064,937 probably benign Het
Sgcz A G 8: 37,545,442 probably benign Het
Slc16a7 A T 10: 125,228,070 V466D probably benign Het
Tbl1xr1 T A 3: 22,189,785 D74E probably benign Het
Ugt2b37 A G 5: 87,254,221 S184P probably benign Het
Other mutations in Ube3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ube3b APN 5 114415287 missense possibly damaging 0.93
IGL01154:Ube3b APN 5 114406252 missense probably null 0.86
IGL02632:Ube3b APN 5 114398841 missense probably benign
IGL02850:Ube3b APN 5 114406249 missense probably damaging 1.00
IGL02878:Ube3b APN 5 114404717 splice site probably null
IGL02881:Ube3b APN 5 114412884 missense possibly damaging 0.78
R0003:Ube3b UTSW 5 114398851 missense probably benign 0.17
R0071:Ube3b UTSW 5 114419497 missense probably damaging 1.00
R0071:Ube3b UTSW 5 114419497 missense probably damaging 1.00
R0076:Ube3b UTSW 5 114408217 critical splice donor site probably null
R0111:Ube3b UTSW 5 114390376 splice site probably benign
R0309:Ube3b UTSW 5 114419469 splice site probably benign
R0718:Ube3b UTSW 5 114402555 nonsense probably null
R1344:Ube3b UTSW 5 114418575 missense probably damaging 1.00
R1350:Ube3b UTSW 5 114406137 intron probably null
R1418:Ube3b UTSW 5 114418575 missense probably damaging 1.00
R1732:Ube3b UTSW 5 114387445 missense probably benign 0.01
R1764:Ube3b UTSW 5 114404617 missense possibly damaging 0.89
R1975:Ube3b UTSW 5 114399865 missense possibly damaging 0.80
R2014:Ube3b UTSW 5 114411149 missense probably damaging 1.00
R2015:Ube3b UTSW 5 114411149 missense probably damaging 1.00
R2041:Ube3b UTSW 5 114387233 missense probably damaging 0.99
R2074:Ube3b UTSW 5 114415255 missense probably benign 0.14
R2202:Ube3b UTSW 5 114389074 missense probably damaging 1.00
R2205:Ube3b UTSW 5 114389074 missense probably damaging 1.00
R3826:Ube3b UTSW 5 114399951 missense probably damaging 0.99
R3829:Ube3b UTSW 5 114399951 missense probably damaging 0.99
R3830:Ube3b UTSW 5 114399951 missense probably damaging 0.99
R3927:Ube3b UTSW 5 114415680 missense probably benign 0.03
R3974:Ube3b UTSW 5 114412430 missense probably benign 0.05
R4049:Ube3b UTSW 5 114412870 missense probably benign 0.09
R4096:Ube3b UTSW 5 114393086 missense possibly damaging 0.65
R4261:Ube3b UTSW 5 114398428 missense possibly damaging 0.80
R4415:Ube3b UTSW 5 114412444 missense probably damaging 1.00
R4688:Ube3b UTSW 5 114393078 missense probably benign 0.03
R4779:Ube3b UTSW 5 114404717 splice site probably null
R4824:Ube3b UTSW 5 114415726 intron probably null
R4868:Ube3b UTSW 5 114398427 missense probably benign 0.00
R4953:Ube3b UTSW 5 114401410 missense probably benign 0.01
R5013:Ube3b UTSW 5 114407641 missense probably damaging 1.00
R5057:Ube3b UTSW 5 114406257 missense probably benign 0.01
R5117:Ube3b UTSW 5 114419631 missense probably damaging 0.96
R5131:Ube3b UTSW 5 114407546 missense probably damaging 1.00
R5498:Ube3b UTSW 5 114418574 missense probably damaging 1.00
R5564:Ube3b UTSW 5 114389075 missense probably damaging 1.00
R5572:Ube3b UTSW 5 114406179 missense probably damaging 0.99
R5580:Ube3b UTSW 5 114415323 missense probably benign
R5596:Ube3b UTSW 5 114406160 splice site probably null
R5843:Ube3b UTSW 5 114412299 missense probably damaging 1.00
R5910:Ube3b UTSW 5 114415309 missense possibly damaging 0.63
R6591:Ube3b UTSW 5 114408124 missense probably benign 0.00
R6691:Ube3b UTSW 5 114408124 missense probably benign 0.00
R7148:Ube3b UTSW 5 114406252 missense probably damaging 0.97
R7334:Ube3b UTSW 5 114415681 missense possibly damaging 0.64
X0017:Ube3b UTSW 5 114415585 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- ACATTAGTTGCTGACCCTGCTGC -3'
(R):5'- TCTAACACAAGCAAGCTCTGCGTC -3'

Sequencing Primer
(F):5'- GACCCTGCTGCTGATCC -3'
(R):5'- GCAAACATGGCCTTCAGG -3'
Posted On2013-08-06