Incidental Mutation 'R0096:Wdr59'
ID64067
Institutional Source Beutler Lab
Gene Symbol Wdr59
Ensembl Gene ENSMUSG00000031959
Gene NameWD repeat domain 59
Synonyms5430401O09Rik
MMRRC Submission 038382-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R0096 (G1)
Quality Score97
Status Validated
Chromosome8
Chromosomal Location111448797-111522092 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111504373 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 68 (N68D)
Ref Sequence ENSEMBL: ENSMUSP00000148397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034437] [ENSMUST00000038193] [ENSMUST00000211981]
Predicted Effect probably damaging
Transcript: ENSMUST00000034437
AA Change: N68D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034437
Gene: ENSMUSG00000031959
AA Change: N68D

DomainStartEndE-ValueType
WD40 41 91 1.37e2 SMART
WD40 94 134 9.52e-6 SMART
WD40 138 176 4.46e-1 SMART
WD40 180 220 2.59e-7 SMART
WD40 271 315 8.59e-1 SMART
RWD 393 494 4.13e-14 SMART
low complexity region 620 632 N/A INTRINSIC
low complexity region 802 813 N/A INTRINSIC
Blast:RING 941 980 3e-10 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000038193
AA Change: N68D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043671
Gene: ENSMUSG00000031959
AA Change: N68D

DomainStartEndE-ValueType
WD40 41 91 1.37e2 SMART
WD40 94 134 9.52e-6 SMART
WD40 138 176 4.46e-1 SMART
WD40 180 220 2.59e-7 SMART
WD40 271 315 8.59e-1 SMART
RWD 393 494 4.13e-14 SMART
low complexity region 803 814 N/A INTRINSIC
Pfam:Zn_ribbon_17 937 992 2e-14 PFAM
Pfam:zinc_ribbon_16 949 990 1.6e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211981
AA Change: N68D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.218 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.5%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A C 6: 48,931,188 Q374P probably damaging Het
4933405L10Rik A T 8: 105,708,931 probably null Het
Adamts3 G A 5: 89,701,717 Q615* probably null Het
Adamtsl3 T A 7: 82,465,699 probably benign Het
Anks1b T C 10: 90,074,062 S48P possibly damaging Het
Arfip2 T A 7: 105,638,230 K94N probably damaging Het
Arhgap42 G T 9: 9,009,313 N524K probably damaging Het
Arhgef28 T G 13: 97,931,254 T1388P probably damaging Het
Arid4b T C 13: 14,129,194 V68A probably benign Het
BC005537 T C 13: 24,805,940 F129L probably damaging Het
Capn3 A T 2: 120,502,529 H592L possibly damaging Het
Ccdc105 T A 10: 78,748,705 I328L probably benign Het
Dglucy A T 12: 100,838,651 I134F possibly damaging Het
Dhh T A 15: 98,893,988 M380L probably benign Het
Dnaic2 A C 11: 114,754,332 D531A probably benign Het
Dthd1 A T 5: 62,843,040 R568S possibly damaging Het
Efr3a A G 15: 65,855,441 N613S probably damaging Het
Epb41l5 T A 1: 119,623,911 probably benign Het
Ermp1 A G 19: 29,631,388 Y164H possibly damaging Het
Fam120c CCAGCAGCAGCAGCAGCA CCAGCAGCAGCAGCA X: 151,344,345 probably benign Het
Fbrs C T 7: 127,489,487 A145V probably damaging Het
Gm4736 T C 6: 132,115,606 noncoding transcript Het
Gm9873 A T 2: 169,021,109 noncoding transcript Het
Grik1 T C 16: 88,034,226 M219V possibly damaging Het
Gtsf1l C T 2: 163,087,536 C9Y probably damaging Het
Itih5 G A 2: 10,251,378 R885Q probably benign Het
Kdm4c A G 4: 74,357,343 E752G probably damaging Het
Ksr1 A G 11: 79,038,247 probably benign Het
Lama1 T A 17: 67,805,413 F2283I probably benign Het
Luc7l3 A G 11: 94,301,494 probably benign Het
Lypd8 A T 11: 58,386,757 M122L probably benign Het
Map1a A G 2: 121,301,505 E696G probably damaging Het
Mrps34 A G 17: 24,895,669 D110G probably damaging Het
Myh11 T A 16: 14,204,367 K1710M possibly damaging Het
Myo1d A G 11: 80,484,332 L972P probably damaging Het
Nos1ap T C 1: 170,329,247 D214G probably damaging Het
Olfr1224-ps1 A T 2: 89,156,296 M293K probably benign Het
Olfr910 A T 9: 38,539,536 I214F probably damaging Het
Pate4 T G 9: 35,611,834 T5P probably damaging Het
Pygl A T 12: 70,191,166 probably benign Het
Samd4 A T 14: 47,064,297 M252L possibly damaging Het
Serpinb1c T A 13: 32,886,283 probably benign Het
Sis A T 3: 72,928,267 W921R probably damaging Het
Skint5 A T 4: 113,597,768 probably benign Het
Slc27a6 T C 18: 58,598,757 probably benign Het
Sycp2 G T 2: 178,403,735 Q31K probably damaging Het
Taar7f A G 10: 24,050,254 M249V probably benign Het
Tarm1 T C 7: 3,497,551 T79A probably benign Het
Trf A G 9: 103,222,159 F300L probably damaging Het
Vmn1r69 T A 7: 10,580,058 I170F probably damaging Het
Vmn2r105 A G 17: 20,227,479 F361S possibly damaging Het
Vmn2r79 A G 7: 87,037,319 Y636C probably damaging Het
Zfp345 T A 2: 150,472,300 H439L probably damaging Het
Other mutations in Wdr59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Wdr59 APN 8 111458736 missense probably damaging 0.98
IGL01330:Wdr59 APN 8 111481933 missense possibly damaging 0.87
IGL01413:Wdr59 APN 8 111501074 missense probably benign 0.23
IGL02306:Wdr59 APN 8 111492733 missense probably damaging 1.00
IGL03027:Wdr59 APN 8 111462192 missense probably damaging 1.00
IGL03057:Wdr59 APN 8 111476118 missense probably damaging 1.00
IGL03204:Wdr59 APN 8 111485370 missense probably benign 0.05
R0056:Wdr59 UTSW 8 111480607 splice site probably benign
R0096:Wdr59 UTSW 8 111504373 missense probably damaging 1.00
R0440:Wdr59 UTSW 8 111480540 small deletion probably benign
R0452:Wdr59 UTSW 8 111521972 missense possibly damaging 0.87
R0472:Wdr59 UTSW 8 111486997 critical splice acceptor site probably null
R0501:Wdr59 UTSW 8 111458947 missense possibly damaging 0.90
R0526:Wdr59 UTSW 8 111480540 small deletion probably benign
R0534:Wdr59 UTSW 8 111480540 small deletion probably benign
R0601:Wdr59 UTSW 8 111480540 small deletion probably benign
R1144:Wdr59 UTSW 8 111486944 missense probably benign 0.09
R1415:Wdr59 UTSW 8 111498596 missense probably damaging 1.00
R1571:Wdr59 UTSW 8 111451050 missense probably damaging 0.98
R1661:Wdr59 UTSW 8 111479362 missense probably damaging 1.00
R1665:Wdr59 UTSW 8 111479362 missense probably damaging 1.00
R1839:Wdr59 UTSW 8 111485340 missense probably benign
R1856:Wdr59 UTSW 8 111476181 missense probably damaging 1.00
R1872:Wdr59 UTSW 8 111459017 missense probably damaging 1.00
R1921:Wdr59 UTSW 8 111486950 nonsense probably null
R1965:Wdr59 UTSW 8 111451077 missense probably damaging 1.00
R1966:Wdr59 UTSW 8 111450903 missense possibly damaging 0.92
R1977:Wdr59 UTSW 8 111458638 missense probably benign 0.00
R2019:Wdr59 UTSW 8 111466793 missense probably damaging 1.00
R4245:Wdr59 UTSW 8 111490364 missense possibly damaging 0.63
R4471:Wdr59 UTSW 8 111466787 critical splice donor site probably null
R4820:Wdr59 UTSW 8 111480814 missense probably benign 0.19
R5198:Wdr59 UTSW 8 111481988 missense probably benign 0.00
R5540:Wdr59 UTSW 8 111485184 missense possibly damaging 0.84
R5571:Wdr59 UTSW 8 111465831 missense probably damaging 1.00
R6166:Wdr59 UTSW 8 111472661 missense probably damaging 1.00
R6732:Wdr59 UTSW 8 111501052 missense probably damaging 1.00
R6767:Wdr59 UTSW 8 111476101 missense probably damaging 1.00
R6823:Wdr59 UTSW 8 111459040 missense possibly damaging 0.95
R6841:Wdr59 UTSW 8 111496880 missense probably damaging 1.00
R6888:Wdr59 UTSW 8 111451043 missense probably benign 0.00
R6974:Wdr59 UTSW 8 111460788 missense possibly damaging 0.86
R6982:Wdr59 UTSW 8 111460813 missense probably benign 0.00
R7066:Wdr59 UTSW 8 111465845 missense probably benign 0.07
X0026:Wdr59 UTSW 8 111479340 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGTCATCTGCCATGCAATCCCTG -3'
(R):5'- CTGAATGTGCTTTTCTAGCGCCG -3'

Sequencing Primer
(F):5'- tcaggagccaccacgtag -3'
(R):5'- ATGCCCCTTTTGAAGGTCAC -3'
Posted On2013-08-06