Incidental Mutation 'R0098:Vmn2r66'
ID64101
Institutional Source Beutler Lab
Gene Symbol Vmn2r66
Ensembl Gene ENSMUSG00000094950
Gene Namevomeronasal 2, receptor 66
SynonymsF830104D24Rik
MMRRC Submission 038384-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R0098 (G1)
Quality Score105
Status Validated
Chromosome7
Chromosomal Location84994645-85012020 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 85005757 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 448 (M448R)
Ref Sequence ENSEMBL: ENSMUSP00000122645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124773]
Predicted Effect probably damaging
Transcript: ENSMUST00000124773
AA Change: M448R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122645
Gene: ENSMUSG00000094950
AA Change: M448R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 463 5e-31 PFAM
Pfam:NCD3G 507 559 6e-21 PFAM
Pfam:7tm_3 589 827 3.8e-52 PFAM
Meta Mutation Damage Score 0.0252 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.2%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,073,540 I97T probably damaging Het
Acpp C T 9: 104,319,945 probably null Het
Adam32 T A 8: 24,914,389 Y200F possibly damaging Het
Alpk2 A G 18: 65,349,911 L342S probably damaging Het
Arfgef3 A G 10: 18,589,642 V2151A probably damaging Het
Atm T C 9: 53,518,569 D389G probably benign Het
Atp10b A T 11: 43,189,604 S236C probably benign Het
B3gat1 C T 9: 26,756,941 R276C probably damaging Het
Cndp1 T A 18: 84,628,824 E246D probably damaging Het
Crebbp A G 16: 4,091,928 L1078P probably damaging Het
Cyp20a1 G T 1: 60,387,254 E452* probably null Het
Emb T C 13: 117,267,498 V262A probably damaging Het
Ephb1 C T 9: 102,041,140 R390H probably damaging Het
Faf1 T C 4: 109,935,499 L556S probably damaging Het
Fbf1 A T 11: 116,148,119 probably null Het
Gid8 T A 2: 180,714,735 I55N possibly damaging Het
Gm8773 T A 5: 5,575,355 L17Q possibly damaging Het
Hexa T C 9: 59,558,100 Y213H probably damaging Het
Kalrn A T 16: 33,975,619 I1262K possibly damaging Het
Lrp1 C T 10: 127,552,738 V3281I probably benign Het
Lrp2 T C 2: 69,475,412 D2935G probably damaging Het
Lypd6 T A 2: 50,190,780 V160E probably benign Het
Muc19 C T 15: 91,892,907 noncoding transcript Het
Mybpc1 T C 10: 88,529,564 D899G probably benign Het
Myo18a A G 11: 77,845,765 E1564G probably damaging Het
Nrxn3 A G 12: 89,260,201 D202G probably damaging Het
Palld C A 8: 61,525,086 G890V probably damaging Het
Pcx C A 19: 4,601,747 probably benign Het
Plcg1 T C 2: 160,732,000 W62R probably damaging Het
Ppa2 C T 3: 133,370,473 probably benign Het
Ppp1r18 A G 17: 35,867,996 I254M probably benign Het
Prune2 A G 19: 17,123,903 E2257G possibly damaging Het
Rd3 A G 1: 191,985,300 M244V probably benign Het
Rfx5 T A 3: 94,958,368 V326E probably damaging Het
Rgs3 G C 4: 62,625,906 R305P probably damaging Het
Rpp40 A G 13: 35,898,987 Y173H probably benign Het
Ryr3 T C 2: 112,901,031 N645D probably damaging Het
Sema3e T C 5: 14,252,432 V657A possibly damaging Het
Serpina3n T A 12: 104,413,518 V390E probably damaging Het
Shank1 A G 7: 44,313,285 Y141C unknown Het
Stat2 T A 10: 128,283,262 H428Q probably damaging Het
Stat5a A T 11: 100,875,626 Q378L probably damaging Het
Tfrc G T 16: 32,623,426 V490F probably damaging Het
Tnnt1 T C 7: 4,509,045 N155S probably damaging Het
Topaz1 T C 9: 122,790,123 Y1262H possibly damaging Het
Ubxn8 T C 8: 33,635,365 probably benign Het
Unk A G 11: 116,050,169 Y252C probably damaging Het
Zfp386 T A 12: 116,059,214 L184* probably null Het
Zfp985 T C 4: 147,577,109 S4P probably damaging Het
Other mutations in Vmn2r66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Vmn2r66 APN 7 85007091 missense probably benign
IGL01562:Vmn2r66 APN 7 85007287 missense probably benign 0.03
IGL01689:Vmn2r66 APN 7 85007825 missense probably damaging 1.00
IGL02237:Vmn2r66 APN 7 84994700 missense probably benign
IGL02415:Vmn2r66 APN 7 85006812 missense probably damaging 0.97
IGL02439:Vmn2r66 APN 7 85005247 splice site probably benign
IGL02545:Vmn2r66 APN 7 85006590 missense possibly damaging 0.50
IGL02708:Vmn2r66 APN 7 85006588 missense probably benign 0.00
IGL02794:Vmn2r66 APN 7 84995415 missense probably benign 0.00
IGL02885:Vmn2r66 APN 7 84995515 missense probably benign 0.00
IGL02975:Vmn2r66 APN 7 85006974 missense probably damaging 0.98
IGL03027:Vmn2r66 APN 7 84995569 splice site probably benign
IGL03081:Vmn2r66 APN 7 85007930 missense probably benign
PIT4131001:Vmn2r66 UTSW 7 84995093 missense probably damaging 1.00
R0504:Vmn2r66 UTSW 7 85006815 missense probably damaging 0.99
R0557:Vmn2r66 UTSW 7 84994764 missense probably damaging 1.00
R0617:Vmn2r66 UTSW 7 84995276 missense probably benign 0.02
R0883:Vmn2r66 UTSW 7 85007862 missense probably benign
R1159:Vmn2r66 UTSW 7 84995405 missense probably benign 0.44
R1168:Vmn2r66 UTSW 7 85006854 missense possibly damaging 0.46
R1172:Vmn2r66 UTSW 7 85005591 missense probably benign 0.04
R1175:Vmn2r66 UTSW 7 85005591 missense probably benign 0.04
R1538:Vmn2r66 UTSW 7 84994958 missense possibly damaging 0.84
R1658:Vmn2r66 UTSW 7 85007747 missense probably benign 0.07
R1937:Vmn2r66 UTSW 7 84995136 missense probably damaging 0.99
R1989:Vmn2r66 UTSW 7 85011993 missense probably benign 0.01
R2698:Vmn2r66 UTSW 7 84995399 missense probably damaging 1.00
R2890:Vmn2r66 UTSW 7 85011819 splice site probably null
R3686:Vmn2r66 UTSW 7 84995189 missense probably damaging 0.96
R4152:Vmn2r66 UTSW 7 85005592 missense probably benign 0.08
R4500:Vmn2r66 UTSW 7 85007954 missense probably damaging 1.00
R4618:Vmn2r66 UTSW 7 84995088 missense possibly damaging 0.62
R4656:Vmn2r66 UTSW 7 85011996 missense possibly damaging 0.87
R4668:Vmn2r66 UTSW 7 84994697 missense probably damaging 1.00
R4942:Vmn2r66 UTSW 7 85007772 missense probably damaging 1.00
R5163:Vmn2r66 UTSW 7 85006809 missense probably benign 0.01
R5223:Vmn2r66 UTSW 7 85007885 missense probably benign
R5377:Vmn2r66 UTSW 7 85006818 missense probably damaging 0.99
R5512:Vmn2r66 UTSW 7 85007941 missense probably damaging 1.00
R5611:Vmn2r66 UTSW 7 85005743 nonsense probably null
R5749:Vmn2r66 UTSW 7 85006771 nonsense probably null
R6131:Vmn2r66 UTSW 7 84995016 missense probably damaging 1.00
R6183:Vmn2r66 UTSW 7 84995558 missense possibly damaging 0.81
R6509:Vmn2r66 UTSW 7 85006846 missense probably benign 0.12
R6930:Vmn2r66 UTSW 7 85012008 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- ACCTGTAGCCCACTTAATCATTTCCGTA -3'
(R):5'- ATCCCATTGCCTGTGATCAAATAACACT -3'

Sequencing Primer
(F):5'- CCGTAGACATAAGTAACTGTTGACC -3'
(R):5'- ACAGAGAACATGCCATTTTTCTCC -3'
Posted On2013-08-06