Incidental Mutation 'R0098:Palld'
ID64104
Institutional Source Beutler Lab
Gene Symbol Palld
Ensembl Gene ENSMUSG00000058056
Gene Namepalladin, cytoskeletal associated protein
Synonyms2410003B16Rik
MMRRC Submission 038384-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0098 (G1)
Quality Score126
Status Validated
Chromosome8
Chromosomal Location61511433-61902690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 61525086 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 890 (G890V)
Ref Sequence ENSEMBL: ENSMUSP00000034057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034057] [ENSMUST00000121200] [ENSMUST00000121493] [ENSMUST00000121785] [ENSMUST00000135439]
PDB Structure
NMR structure of Ig3 domain of palladin [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000034057
AA Change: G890V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034057
Gene: ENSMUSG00000058056
AA Change: G890V

DomainStartEndE-ValueType
IGc2 290 358 1.45e-9 SMART
low complexity region 372 385 N/A INTRINSIC
IGc2 460 535 1.6e-11 SMART
low complexity region 639 667 N/A INTRINSIC
IGc2 796 865 3.1e-9 SMART
low complexity region 881 906 N/A INTRINSIC
IGc2 930 998 4.92e-12 SMART
IGc2 1029 1098 1.61e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121200
AA Change: G387V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112374
Gene: ENSMUSG00000058056
AA Change: G387V

DomainStartEndE-ValueType
low complexity region 37 68 N/A INTRINSIC
low complexity region 77 112 N/A INTRINSIC
IGc2 293 362 3.1e-9 SMART
low complexity region 378 403 N/A INTRINSIC
IGc2 427 495 4.92e-12 SMART
IGc2 526 595 1.61e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121493
AA Change: G726V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113874
Gene: ENSMUSG00000058056
AA Change: G726V

DomainStartEndE-ValueType
IGc2 71 146 1.6e-11 SMART
low complexity region 250 284 N/A INTRINSIC
low complexity region 298 326 N/A INTRINSIC
low complexity region 376 407 N/A INTRINSIC
low complexity region 416 451 N/A INTRINSIC
IGc2 632 701 3.1e-9 SMART
low complexity region 717 742 N/A INTRINSIC
IGc2 766 834 4.92e-12 SMART
IGc2 865 934 1.61e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000121785
AA Change: G1132V
SMART Domains Protein: ENSMUSP00000112442
Gene: ENSMUSG00000058056
AA Change: G1132V

DomainStartEndE-ValueType
IGc2 290 358 1.45e-9 SMART
low complexity region 372 385 N/A INTRINSIC
IGc2 460 535 1.6e-11 SMART
low complexity region 639 673 N/A INTRINSIC
low complexity region 687 715 N/A INTRINSIC
low complexity region 765 796 N/A INTRINSIC
low complexity region 805 840 N/A INTRINSIC
IGc2 1038 1107 3.1e-9 SMART
low complexity region 1123 1148 N/A INTRINSIC
IGc2 1172 1240 4.92e-12 SMART
IGc2 1271 1340 1.61e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000135439
AA Change: G176V

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119792
Gene: ENSMUSG00000058056
AA Change: G176V

DomainStartEndE-ValueType
IGc2 82 151 3.1e-9 SMART
low complexity region 167 192 N/A INTRINSIC
IGc2 216 284 4.92e-12 SMART
internal_repeat_1 302 336 1.47e-9 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136825
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.2%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is required for organizing the actin cytoskeleton. The protein is a component of actin-containing microfilaments, and it is involved in the control of cell shape, adhesion, and contraction. Polymorphisms in this gene are associated with a susceptibility to pancreatic cancer type 1, and also with a risk for myocardial infarction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: All homozygous null embryos die around E15.5 displaying exencephaly derived from neural tube closure defects, and herniation of the intestine and liver due to ventral closure defects. Mutant MEFs show impaired formation of actin stress fibers, reduced migration and decreased adhesion to fibronectin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,073,540 I97T probably damaging Het
Acpp C T 9: 104,319,945 probably null Het
Adam32 T A 8: 24,914,389 Y200F possibly damaging Het
Alpk2 A G 18: 65,349,911 L342S probably damaging Het
Arfgef3 A G 10: 18,589,642 V2151A probably damaging Het
Atm T C 9: 53,518,569 D389G probably benign Het
Atp10b A T 11: 43,189,604 S236C probably benign Het
B3gat1 C T 9: 26,756,941 R276C probably damaging Het
Cndp1 T A 18: 84,628,824 E246D probably damaging Het
Crebbp A G 16: 4,091,928 L1078P probably damaging Het
Cyp20a1 G T 1: 60,387,254 E452* probably null Het
Emb T C 13: 117,267,498 V262A probably damaging Het
Ephb1 C T 9: 102,041,140 R390H probably damaging Het
Faf1 T C 4: 109,935,499 L556S probably damaging Het
Fbf1 A T 11: 116,148,119 probably null Het
Gid8 T A 2: 180,714,735 I55N possibly damaging Het
Gm8773 T A 5: 5,575,355 L17Q possibly damaging Het
Hexa T C 9: 59,558,100 Y213H probably damaging Het
Kalrn A T 16: 33,975,619 I1262K possibly damaging Het
Lrp1 C T 10: 127,552,738 V3281I probably benign Het
Lrp2 T C 2: 69,475,412 D2935G probably damaging Het
Lypd6 T A 2: 50,190,780 V160E probably benign Het
Muc19 C T 15: 91,892,907 noncoding transcript Het
Mybpc1 T C 10: 88,529,564 D899G probably benign Het
Myo18a A G 11: 77,845,765 E1564G probably damaging Het
Nrxn3 A G 12: 89,260,201 D202G probably damaging Het
Pcx C A 19: 4,601,747 probably benign Het
Plcg1 T C 2: 160,732,000 W62R probably damaging Het
Ppa2 C T 3: 133,370,473 probably benign Het
Ppp1r18 A G 17: 35,867,996 I254M probably benign Het
Prune2 A G 19: 17,123,903 E2257G possibly damaging Het
Rd3 A G 1: 191,985,300 M244V probably benign Het
Rfx5 T A 3: 94,958,368 V326E probably damaging Het
Rgs3 G C 4: 62,625,906 R305P probably damaging Het
Rpp40 A G 13: 35,898,987 Y173H probably benign Het
Ryr3 T C 2: 112,901,031 N645D probably damaging Het
Sema3e T C 5: 14,252,432 V657A possibly damaging Het
Serpina3n T A 12: 104,413,518 V390E probably damaging Het
Shank1 A G 7: 44,313,285 Y141C unknown Het
Stat2 T A 10: 128,283,262 H428Q probably damaging Het
Stat5a A T 11: 100,875,626 Q378L probably damaging Het
Tfrc G T 16: 32,623,426 V490F probably damaging Het
Tnnt1 T C 7: 4,509,045 N155S probably damaging Het
Topaz1 T C 9: 122,790,123 Y1262H possibly damaging Het
Ubxn8 T C 8: 33,635,365 probably benign Het
Unk A G 11: 116,050,169 Y252C probably damaging Het
Vmn2r66 A C 7: 85,005,757 M448R probably damaging Het
Zfp386 T A 12: 116,059,214 L184* probably null Het
Zfp985 T C 4: 147,577,109 S4P probably damaging Het
Other mutations in Palld
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Palld APN 8 61515935 missense possibly damaging 0.77
IGL01083:Palld APN 8 61538807 missense probably benign 0.44
IGL01644:Palld APN 8 61877478 missense probably benign 0.28
IGL01672:Palld APN 8 61877502 missense probably benign 0.22
IGL01941:Palld APN 8 61535700 missense probably benign 0.44
IGL02037:Palld APN 8 61525114 missense probably damaging 1.00
IGL02126:Palld APN 8 61877442 missense possibly damaging 0.82
IGL02537:Palld APN 8 61684934 missense probably benign 0.05
IGL02632:Palld APN 8 61515245 missense probably damaging 1.00
IGL02809:Palld APN 8 61515247 missense probably damaging 1.00
IGL02901:Palld APN 8 61876995 nonsense probably null
IGL03400:Palld APN 8 61513455 missense probably damaging 1.00
R0098:Palld UTSW 8 61525086 missense probably damaging 1.00
R0745:Palld UTSW 8 61877703 missense probably damaging 1.00
R1263:Palld UTSW 8 61513457 frame shift probably null
R1342:Palld UTSW 8 61522882 critical splice donor site probably null
R1893:Palld UTSW 8 61516621 missense probably damaging 1.00
R2017:Palld UTSW 8 61684765 missense probably damaging 0.99
R2102:Palld UTSW 8 61533433 missense possibly damaging 0.82
R2129:Palld UTSW 8 61877361 missense probably benign 0.00
R2246:Palld UTSW 8 61877135 missense probably benign 0.01
R3545:Palld UTSW 8 61550078 missense possibly damaging 0.95
R3815:Palld UTSW 8 61549837 intron probably benign
R3824:Palld UTSW 8 61709033 missense probably damaging 1.00
R4412:Palld UTSW 8 61687372 missense probably damaging 0.98
R4781:Palld UTSW 8 61877028 missense probably benign 0.01
R4836:Palld UTSW 8 61687381 missense probably benign 0.11
R4871:Palld UTSW 8 61549781 intron probably benign
R4963:Palld UTSW 8 61703210 missense probably damaging 1.00
R5036:Palld UTSW 8 61550162 missense probably damaging 1.00
R5128:Palld UTSW 8 61720588 missense probably damaging 1.00
R5343:Palld UTSW 8 61549815 intron probably benign
R5421:Palld UTSW 8 61516550 missense probably damaging 1.00
R5427:Palld UTSW 8 61550072 missense probably benign 0.01
R5561:Palld UTSW 8 61516585 missense probably damaging 1.00
R5651:Palld UTSW 8 61538788 missense probably damaging 1.00
R5679:Palld UTSW 8 61684945 missense possibly damaging 0.95
R5915:Palld UTSW 8 61533352 critical splice donor site probably null
R6153:Palld UTSW 8 61550152 missense probably damaging 1.00
R6276:Palld UTSW 8 61513423 missense probably damaging 1.00
R6323:Palld UTSW 8 61720693 missense probably damaging 1.00
R6659:Palld UTSW 8 61533443 missense probably benign 0.28
R7016:Palld UTSW 8 61515998 missense probably damaging 1.00
R7124:Palld UTSW 8 61516645 missense unknown
R7145:Palld UTSW 8 61532017 missense unknown
Predicted Primers PCR Primer
(F):5'- GCCACGTAAAGGCCGTGAATCTTG -3'
(R):5'- TCGGAAAGCCCTTATGTTGCAGATG -3'

Sequencing Primer
(F):5'- AAGGCCGTGAATCTTGACTTTC -3'
(R):5'- GATAAAACCATCTCTTGTCACCTG -3'
Posted On2013-08-06