Incidental Mutation 'R0098:Pcx'
ID64119
Institutional Source Beutler Lab
Gene Symbol Pcx
Ensembl Gene ENSMUSG00000024892
Gene Namepyruvate carboxylase
SynonymsPc
MMRRC Submission 038384-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0098 (G1)
Quality Score106
Status Validated
Chromosome19
Chromosomal Location4510472-4621752 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 4601747 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068004] [ENSMUST00000113825] [ENSMUST00000224726] [ENSMUST00000225189]
Predicted Effect probably benign
Transcript: ENSMUST00000068004
SMART Domains Protein: ENSMUSP00000063825
Gene: ENSMUSG00000024892

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
Pfam:CPSase_L_chain 37 147 3.3e-45 PFAM
Pfam:ATP-grasp_4 149 334 3.9e-19 PFAM
Pfam:CPSase_L_D2 152 361 7.2e-77 PFAM
Pfam:Dala_Dala_lig_C 161 329 1.5e-11 PFAM
Biotin_carb_C 376 483 1.21e-50 SMART
low complexity region 513 541 N/A INTRINSIC
Pfam:HMGL-like 564 838 8.2e-29 PFAM
Pfam:PYC_OADA 862 1062 1.4e-72 PFAM
Pfam:Biotin_lipoyl 1111 1178 1.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113825
SMART Domains Protein: ENSMUSP00000109456
Gene: ENSMUSG00000024892

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
Pfam:CPSase_L_chain 36 146 1.1e-43 PFAM
Pfam:ATP-grasp_4 148 332 2.9e-19 PFAM
Pfam:CPSase_L_D2 151 360 4.2e-77 PFAM
Pfam:Dala_Dala_lig_C 158 328 7.9e-13 PFAM
Biotin_carb_C 375 482 1.21e-50 SMART
low complexity region 512 540 N/A INTRINSIC
Pfam:HMGL-like 571 821 3.4e-28 PFAM
Pfam:PYC_OADA 861 1062 3.4e-69 PFAM
Pfam:Biotin_lipoyl 1110 1177 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224726
Predicted Effect probably benign
Transcript: ENSMUST00000225189
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.2%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes pyruvate carboxylase, which requires biotin and ATP to catalyse the carboxylation of pyruvate to oxaloacetate. The active enzyme is a homotetramer arranged in a tetrahedron which is located exclusively in the mitochondrial matrix. Pyruvate carboxylase is involved in gluconeogenesis, lipogenesis, insulin secretion and synthesis of the neurotransmitter glutamate. Mutations in this gene have been associated with pyruvate carboxylase deficiency. Alternatively spliced transcript variants with different 5' UTRs, but encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,073,540 I97T probably damaging Het
Acpp C T 9: 104,319,945 probably null Het
Adam32 T A 8: 24,914,389 Y200F possibly damaging Het
Alpk2 A G 18: 65,349,911 L342S probably damaging Het
Arfgef3 A G 10: 18,589,642 V2151A probably damaging Het
Atm T C 9: 53,518,569 D389G probably benign Het
Atp10b A T 11: 43,189,604 S236C probably benign Het
B3gat1 C T 9: 26,756,941 R276C probably damaging Het
Cndp1 T A 18: 84,628,824 E246D probably damaging Het
Crebbp A G 16: 4,091,928 L1078P probably damaging Het
Cyp20a1 G T 1: 60,387,254 E452* probably null Het
Emb T C 13: 117,267,498 V262A probably damaging Het
Ephb1 C T 9: 102,041,140 R390H probably damaging Het
Faf1 T C 4: 109,935,499 L556S probably damaging Het
Fbf1 A T 11: 116,148,119 probably null Het
Gid8 T A 2: 180,714,735 I55N possibly damaging Het
Gm8773 T A 5: 5,575,355 L17Q possibly damaging Het
Hexa T C 9: 59,558,100 Y213H probably damaging Het
Kalrn A T 16: 33,975,619 I1262K possibly damaging Het
Lrp1 C T 10: 127,552,738 V3281I probably benign Het
Lrp2 T C 2: 69,475,412 D2935G probably damaging Het
Lypd6 T A 2: 50,190,780 V160E probably benign Het
Muc19 C T 15: 91,892,907 noncoding transcript Het
Mybpc1 T C 10: 88,529,564 D899G probably benign Het
Myo18a A G 11: 77,845,765 E1564G probably damaging Het
Nrxn3 A G 12: 89,260,201 D202G probably damaging Het
Palld C A 8: 61,525,086 G890V probably damaging Het
Plcg1 T C 2: 160,732,000 W62R probably damaging Het
Ppa2 C T 3: 133,370,473 probably benign Het
Ppp1r18 A G 17: 35,867,996 I254M probably benign Het
Prune2 A G 19: 17,123,903 E2257G possibly damaging Het
Rd3 A G 1: 191,985,300 M244V probably benign Het
Rfx5 T A 3: 94,958,368 V326E probably damaging Het
Rgs3 G C 4: 62,625,906 R305P probably damaging Het
Rpp40 A G 13: 35,898,987 Y173H probably benign Het
Ryr3 T C 2: 112,901,031 N645D probably damaging Het
Sema3e T C 5: 14,252,432 V657A possibly damaging Het
Serpina3n T A 12: 104,413,518 V390E probably damaging Het
Shank1 A G 7: 44,313,285 Y141C unknown Het
Stat2 T A 10: 128,283,262 H428Q probably damaging Het
Stat5a A T 11: 100,875,626 Q378L probably damaging Het
Tfrc G T 16: 32,623,426 V490F probably damaging Het
Tnnt1 T C 7: 4,509,045 N155S probably damaging Het
Topaz1 T C 9: 122,790,123 Y1262H possibly damaging Het
Ubxn8 T C 8: 33,635,365 probably benign Het
Unk A G 11: 116,050,169 Y252C probably damaging Het
Vmn2r66 A C 7: 85,005,757 M448R probably damaging Het
Zfp386 T A 12: 116,059,214 L184* probably null Het
Zfp985 T C 4: 147,577,109 S4P probably damaging Het
Other mutations in Pcx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Pcx APN 19 4620937 missense probably benign 0.02
IGL01339:Pcx APN 19 4620235 unclassified probably null
IGL01373:Pcx APN 19 4620235 unclassified probably null
IGL01704:Pcx APN 19 4621060 missense probably damaging 1.00
IGL02223:Pcx APN 19 4601978 missense probably damaging 1.00
PIT4151001:Pcx UTSW 19 4603129 missense probably damaging 1.00
R0098:Pcx UTSW 19 4601747 splice site probably benign
R0211:Pcx UTSW 19 4620199 missense probably damaging 1.00
R0211:Pcx UTSW 19 4620199 missense probably damaging 1.00
R0398:Pcx UTSW 19 4601610 missense probably benign 0.35
R0414:Pcx UTSW 19 4607642 missense possibly damaging 0.60
R1402:Pcx UTSW 19 4602030 missense possibly damaging 0.59
R1402:Pcx UTSW 19 4602030 missense possibly damaging 0.59
R1479:Pcx UTSW 19 4602024 missense probably damaging 1.00
R1543:Pcx UTSW 19 4602223 missense probably damaging 1.00
R1559:Pcx UTSW 19 4619086 missense probably damaging 1.00
R1607:Pcx UTSW 19 4603159 missense possibly damaging 0.89
R1833:Pcx UTSW 19 4619104 missense probably damaging 0.98
R1866:Pcx UTSW 19 4621221 missense possibly damaging 0.58
R2131:Pcx UTSW 19 4602551 missense probably benign 0.00
R2172:Pcx UTSW 19 4620881 missense probably benign 0.17
R2224:Pcx UTSW 19 4617998 missense possibly damaging 0.46
R2226:Pcx UTSW 19 4617998 missense possibly damaging 0.46
R2280:Pcx UTSW 19 4604543 missense probably damaging 1.00
R3950:Pcx UTSW 19 4617967 missense probably benign 0.00
R3952:Pcx UTSW 19 4617967 missense probably benign 0.00
R4205:Pcx UTSW 19 4619166 missense possibly damaging 0.95
R4409:Pcx UTSW 19 4610003 missense possibly damaging 0.65
R4670:Pcx UTSW 19 4619888 missense probably damaging 1.00
R4691:Pcx UTSW 19 4619477 missense probably damaging 0.99
R4728:Pcx UTSW 19 4603096 missense probably damaging 1.00
R4808:Pcx UTSW 19 4620928 missense probably benign 0.00
R5200:Pcx UTSW 19 4618504 missense probably damaging 1.00
R5454:Pcx UTSW 19 4602476 missense probably damaging 1.00
R5621:Pcx UTSW 19 4619167 missense possibly damaging 0.59
R5990:Pcx UTSW 19 4621266 missense probably damaging 1.00
R6519:Pcx UTSW 19 4602211 missense possibly damaging 0.64
R6526:Pcx UTSW 19 4604495 missense probably benign 0.44
R7202:Pcx UTSW 19 4602333 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TGGGTTAGATTTGCTTGCTCTCCAC -3'
(R):5'- GGCCACCTTGATGATGTCTGGAATG -3'

Sequencing Primer
(F):5'- GTAGCCTGCTCTAACCTAGAC -3'
(R):5'- AAGGTAGGCTTCATCAGCTTTC -3'
Posted On2013-08-06