Incidental Mutation 'R0100:Osgepl1'
ID64120
Institutional Source Beutler Lab
Gene Symbol Osgepl1
Ensembl Gene ENSMUSG00000026096
Gene NameO-sialoglycoprotein endopeptidase-like 1
Synonyms2610001M19Rik, MGC13061
MMRRC Submission 038386-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R0100 (G1)
Quality Score113
Status Validated
Chromosome1
Chromosomal Location53313624-53326343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53323213 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 405 (I405V)
Ref Sequence ENSEMBL: ENSMUSP00000110128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027265] [ENSMUST00000114484] [ENSMUST00000135614] [ENSMUST00000144660] [ENSMUST00000151296]
Predicted Effect probably damaging
Transcript: ENSMUST00000027265
AA Change: I405V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027265
Gene: ENSMUSG00000026096
AA Change: I405V

DomainStartEndE-ValueType
Pfam:Peptidase_M22 59 365 1.1e-79 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114484
AA Change: I405V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110128
Gene: ENSMUSG00000026096
AA Change: I405V

DomainStartEndE-ValueType
Pfam:Peptidase_M22 59 365 1.1e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135614
SMART Domains Protein: ENSMUSP00000137994
Gene: ENSMUSG00000026096

DomainStartEndE-ValueType
Pfam:Peptidase_M22 59 365 7.6e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144660
SMART Domains Protein: ENSMUSP00000139404
Gene: ENSMUSG00000099913

DomainStartEndE-ValueType
Pfam:GATase_7 59 162 1.4e-8 PFAM
Pfam:Asn_synthase 304 565 5.6e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150115
Predicted Effect probably benign
Transcript: ENSMUST00000151296
SMART Domains Protein: ENSMUSP00000137772
Gene: ENSMUSG00000026096

DomainStartEndE-ValueType
SCOP:d1huxa_ 37 63 4e-8 SMART
PDB:3ZEU|E 39 72 1e-5 PDB
low complexity region 78 85 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153939
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186588
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188688
Meta Mutation Damage Score 0.358 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,254,011 I442T possibly damaging Het
Agrn A G 4: 156,174,958 C814R probably damaging Het
Bbof1 T A 12: 84,411,055 D31E probably benign Het
Ccdc51 C T 9: 109,091,998 Q318* probably null Het
Cpxm2 T A 7: 132,054,871 H554L possibly damaging Het
Dbr1 T A 9: 99,583,669 D433E probably benign Het
Ddx55 C T 5: 124,556,782 T91I probably damaging Het
Dhx57 T C 17: 80,275,156 D340G possibly damaging Het
Dnah1 C T 14: 31,262,152 probably null Het
Dpp9 C T 17: 56,205,854 G118D possibly damaging Het
Fam81a C T 9: 70,102,809 probably benign Het
Fat4 A C 3: 38,980,248 N2683T probably damaging Het
Fbxo47 C T 11: 97,868,606 G165S probably damaging Het
Gpatch2 C A 1: 187,225,817 A123E probably damaging Het
Greb1 T A 12: 16,680,224 Q1734L probably benign Het
Gtf2ird2 T C 5: 134,217,015 L705P probably damaging Het
H13 T A 2: 152,689,863 probably null Het
Hip1 T C 5: 135,436,453 D367G probably benign Het
Ift140 C T 17: 25,090,954 Q1112* probably null Het
Il17b A G 18: 61,690,271 M59V probably benign Het
Lpin3 T C 2: 160,905,340 Y829H probably damaging Het
Mocs3 C T 2: 168,231,190 R186C probably damaging Het
Olfr1105 T C 2: 87,033,595 T209A probably benign Het
Olfr121 T C 17: 37,752,703 F283S probably benign Het
Olfr1225 T A 2: 89,171,087 I42F probably benign Het
Olfr1344 C T 7: 6,440,400 R167C probably damaging Het
Pdcd11 T C 19: 47,102,666 S360P probably benign Het
Plekhs1 A G 19: 56,478,502 E255G probably damaging Het
Tex22 T A 12: 113,088,772 I150N probably benign Het
Tmem106a T C 11: 101,586,258 S98P probably benign Het
Tnfrsf18 A G 4: 156,028,366 T170A probably benign Het
Trpc6 C T 9: 8,653,034 P614S probably damaging Het
Usp28 C A 9: 49,035,932 P566Q probably damaging Het
Washc5 A G 15: 59,344,098 F811L possibly damaging Het
Other mutations in Osgepl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Osgepl1 APN 1 53320246 missense probably benign 0.07
IGL00774:Osgepl1 APN 1 53320246 missense probably benign 0.07
IGL02672:Osgepl1 APN 1 53320111 missense probably benign
IGL02932:Osgepl1 APN 1 53321516 missense probably benign 0.01
IGL03269:Osgepl1 APN 1 53321112 nonsense probably null
H8562:Osgepl1 UTSW 1 53315039 missense probably damaging 1.00
R0100:Osgepl1 UTSW 1 53323213 missense probably damaging 0.99
R0519:Osgepl1 UTSW 1 53321096 missense probably damaging 1.00
R0739:Osgepl1 UTSW 1 53323195 nonsense probably null
R1724:Osgepl1 UTSW 1 53317903 missense probably benign 0.06
R3793:Osgepl1 UTSW 1 53320247 missense probably damaging 0.97
R4214:Osgepl1 UTSW 1 53315008 missense probably damaging 1.00
R5009:Osgepl1 UTSW 1 53318180 missense probably damaging 1.00
R5721:Osgepl1 UTSW 1 53321200 missense possibly damaging 0.88
R5890:Osgepl1 UTSW 1 53318167 missense probably damaging 1.00
R6479:Osgepl1 UTSW 1 53321543 missense probably benign 0.00
R7046:Osgepl1 UTSW 1 53321551 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGGCCCAGCATTCATTTTGATTTAAGC -3'
(R):5'- ACGTGCCCCTCCAGGACTATG -3'

Sequencing Primer
(F):5'- AAGAATGAGGCATTGTTCTGC -3'
(R):5'- TCCAGGACTATGTATACACACACAAA -3'
Posted On2013-08-06