Incidental Mutation 'R0100:Trpc6'
ID64128
Institutional Source Beutler Lab
Gene Symbol Trpc6
Ensembl Gene ENSMUSG00000031997
Gene Nametransient receptor potential cation channel, subfamily C, member 6
Synonymsmtrp6, Trrp6
MMRRC Submission 038386-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0100 (G1)
Quality Score117
Status Validated
Chromosome9
Chromosomal Location8544142-8680741 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 8653034 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 614 (P614S)
Ref Sequence ENSEMBL: ENSMUSP00000057965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050433] [ENSMUST00000214596]
Predicted Effect probably damaging
Transcript: ENSMUST00000050433
AA Change: P614S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057965
Gene: ENSMUSG00000031997
AA Change: P614S

DomainStartEndE-ValueType
low complexity region 37 54 N/A INTRINSIC
ANK 96 125 4.73e2 SMART
ANK 131 159 3.49e0 SMART
ANK 217 246 6.61e-1 SMART
Pfam:TRP_2 252 314 4e-29 PFAM
transmembrane domain 406 427 N/A INTRINSIC
Pfam:Ion_trans 442 738 4.2e-38 PFAM
Pfam:PKD_channel 477 733 3.1e-16 PFAM
low complexity region 770 781 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000214596
AA Change: P536S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215328
Meta Mutation Damage Score 0.24 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a receptor-activated calcium channel in the cell membrane. The channel is activated by diacylglycerol and is thought to be under the control of a phosphatidylinositol second messenger system. Activation of this channel occurs independently of protein kinase C and is not triggered by low levels of intracellular calcium. Defects in this gene are a cause of focal segmental glomerulosclerosis 2 (FSGS2). [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for one null targeted mutation are viable and fertile and exhibit no overt abnormal phenotype. Another knockout results in an increase in thermal nociceptive response latency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,254,011 I442T possibly damaging Het
Agrn A G 4: 156,174,958 C814R probably damaging Het
Bbof1 T A 12: 84,411,055 D31E probably benign Het
Ccdc51 C T 9: 109,091,998 Q318* probably null Het
Cpxm2 T A 7: 132,054,871 H554L possibly damaging Het
Dbr1 T A 9: 99,583,669 D433E probably benign Het
Ddx55 C T 5: 124,556,782 T91I probably damaging Het
Dhx57 T C 17: 80,275,156 D340G possibly damaging Het
Dnah1 C T 14: 31,262,152 probably null Het
Dpp9 C T 17: 56,205,854 G118D possibly damaging Het
Fam81a C T 9: 70,102,809 probably benign Het
Fat4 A C 3: 38,980,248 N2683T probably damaging Het
Fbxo47 C T 11: 97,868,606 G165S probably damaging Het
Gpatch2 C A 1: 187,225,817 A123E probably damaging Het
Greb1 T A 12: 16,680,224 Q1734L probably benign Het
Gtf2ird2 T C 5: 134,217,015 L705P probably damaging Het
H13 T A 2: 152,689,863 probably null Het
Hip1 T C 5: 135,436,453 D367G probably benign Het
Ift140 C T 17: 25,090,954 Q1112* probably null Het
Il17b A G 18: 61,690,271 M59V probably benign Het
Lpin3 T C 2: 160,905,340 Y829H probably damaging Het
Mocs3 C T 2: 168,231,190 R186C probably damaging Het
Olfr1105 T C 2: 87,033,595 T209A probably benign Het
Olfr121 T C 17: 37,752,703 F283S probably benign Het
Olfr1225 T A 2: 89,171,087 I42F probably benign Het
Olfr1344 C T 7: 6,440,400 R167C probably damaging Het
Osgepl1 A G 1: 53,323,213 I405V probably damaging Het
Pdcd11 T C 19: 47,102,666 S360P probably benign Het
Plekhs1 A G 19: 56,478,502 E255G probably damaging Het
Tex22 T A 12: 113,088,772 I150N probably benign Het
Tmem106a T C 11: 101,586,258 S98P probably benign Het
Tnfrsf18 A G 4: 156,028,366 T170A probably benign Het
Usp28 C A 9: 49,035,932 P566Q probably damaging Het
Washc5 A G 15: 59,344,098 F811L possibly damaging Het
Other mutations in Trpc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Trpc6 APN 9 8680438 missense probably damaging 1.00
IGL00469:Trpc6 APN 9 8626701 missense probably benign
IGL00970:Trpc6 APN 9 8653151 missense probably damaging 1.00
IGL01299:Trpc6 APN 9 8653061 missense probably damaging 1.00
IGL01563:Trpc6 APN 9 8656603 missense probably damaging 1.00
IGL01578:Trpc6 APN 9 8634057 missense probably damaging 1.00
IGL02657:Trpc6 APN 9 8643601 missense possibly damaging 0.94
IGL02735:Trpc6 APN 9 8655338 missense probably damaging 1.00
IGL03102:Trpc6 APN 9 8649301 missense probably benign 0.07
P0038:Trpc6 UTSW 9 8649511 missense possibly damaging 0.52
PIT4531001:Trpc6 UTSW 9 8610148 missense probably benign 0.14
R0100:Trpc6 UTSW 9 8653034 missense probably damaging 1.00
R0323:Trpc6 UTSW 9 8610275 missense probably damaging 1.00
R0323:Trpc6 UTSW 9 8643536 missense probably damaging 1.00
R0334:Trpc6 UTSW 9 8610343 missense probably damaging 1.00
R0665:Trpc6 UTSW 9 8634122 missense probably benign 0.11
R0948:Trpc6 UTSW 9 8610415 missense possibly damaging 0.60
R1177:Trpc6 UTSW 9 8658304 missense probably benign 0.04
R1217:Trpc6 UTSW 9 8658286 intron probably null
R1445:Trpc6 UTSW 9 8680537 missense probably benign 0.00
R1452:Trpc6 UTSW 9 8653147 missense probably damaging 0.99
R1494:Trpc6 UTSW 9 8658304 missense probably benign 0.04
R1501:Trpc6 UTSW 9 8610169 missense probably damaging 0.99
R1933:Trpc6 UTSW 9 8656545 missense probably damaging 1.00
R2112:Trpc6 UTSW 9 8656612 missense probably damaging 1.00
R2164:Trpc6 UTSW 9 8610465 nonsense probably null
R2921:Trpc6 UTSW 9 8653033 missense possibly damaging 0.94
R2995:Trpc6 UTSW 9 8544466 missense probably benign 0.30
R3821:Trpc6 UTSW 9 8610278 missense probably damaging 1.00
R3965:Trpc6 UTSW 9 8626621 missense probably damaging 1.00
R4360:Trpc6 UTSW 9 8610266 missense probably benign 0.10
R4625:Trpc6 UTSW 9 8677962 missense probably benign 0.40
R4691:Trpc6 UTSW 9 8652978 missense probably damaging 1.00
R4736:Trpc6 UTSW 9 8609870 missense probably damaging 1.00
R4767:Trpc6 UTSW 9 8643686 missense probably damaging 1.00
R4773:Trpc6 UTSW 9 8609851 missense possibly damaging 0.78
R4792:Trpc6 UTSW 9 8626614 missense probably benign 0.00
R5105:Trpc6 UTSW 9 8649470 missense probably benign
R5319:Trpc6 UTSW 9 8609921 missense probably damaging 1.00
R5429:Trpc6 UTSW 9 8634074 nonsense probably null
R5505:Trpc6 UTSW 9 8626735 missense probably damaging 1.00
R5657:Trpc6 UTSW 9 8609807 missense probably benign 0.11
R5684:Trpc6 UTSW 9 8653128 missense probably damaging 1.00
R5722:Trpc6 UTSW 9 8680549 missense possibly damaging 0.88
R6210:Trpc6 UTSW 9 8656730 missense probably benign 0.42
R6284:Trpc6 UTSW 9 8643600 missense possibly damaging 0.93
R6773:Trpc6 UTSW 9 8634057 missense probably damaging 1.00
R6874:Trpc6 UTSW 9 8680438 missense probably damaging 1.00
R7032:Trpc6 UTSW 9 8609950 missense probably damaging 1.00
R7142:Trpc6 UTSW 9 8653016 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACACACTTGAGAAGTTCTTCAGAGCAC -3'
(R):5'- GAGCACCACATACGTTGTGAATGC -3'

Sequencing Primer
(F):5'- CAGAGCACAAGGTTTTACTTGG -3'
(R):5'- CATACGTTGTGAATGCTTCATTCTG -3'
Posted On2013-08-06