Incidental Mutation 'R0100:Il17b'
ID64138
Institutional Source Beutler Lab
Gene Symbol Il17b
Ensembl Gene ENSMUSG00000024578
Gene Nameinterleukin 17B
SynonymsZcyto7, 1700006N07Rik, 1110006O16Rik
MMRRC Submission 038386-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R0100 (G1)
Quality Score138
Status Validated
Chromosome18
Chromosomal Location61687935-61692537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61690271 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 59 (M59V)
Ref Sequence ENSEMBL: ENSMUSP00000025471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025471]
Predicted Effect probably benign
Transcript: ENSMUST00000025471
AA Change: M59V

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000025471
Gene: ENSMUSG00000024578
AA Change: M59V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:IL17 96 179 1.4e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191654
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a T cell-derived cytokine that shares sequence similarity with IL17. This cytokine was reported to stimulate the release of TNF alpha (TNF) and IL1 beta (IL1B) from a monocytic cell line. Immunohistochemical analysis of several nerve tissues indicated that this cytokine is primarily localized to neuronal cell bodies. Alternative splicing results in multiple splice variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased susceptibility to DDS-induced colitis and Citrobacter rodentium infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,254,011 I442T possibly damaging Het
Agrn A G 4: 156,174,958 C814R probably damaging Het
Bbof1 T A 12: 84,411,055 D31E probably benign Het
Ccdc51 C T 9: 109,091,998 Q318* probably null Het
Cpxm2 T A 7: 132,054,871 H554L possibly damaging Het
Dbr1 T A 9: 99,583,669 D433E probably benign Het
Ddx55 C T 5: 124,556,782 T91I probably damaging Het
Dhx57 T C 17: 80,275,156 D340G possibly damaging Het
Dnah1 C T 14: 31,262,152 probably null Het
Dpp9 C T 17: 56,205,854 G118D possibly damaging Het
Fam81a C T 9: 70,102,809 probably benign Het
Fat4 A C 3: 38,980,248 N2683T probably damaging Het
Fbxo47 C T 11: 97,868,606 G165S probably damaging Het
Gpatch2 C A 1: 187,225,817 A123E probably damaging Het
Greb1 T A 12: 16,680,224 Q1734L probably benign Het
Gtf2ird2 T C 5: 134,217,015 L705P probably damaging Het
H13 T A 2: 152,689,863 probably null Het
Hip1 T C 5: 135,436,453 D367G probably benign Het
Ift140 C T 17: 25,090,954 Q1112* probably null Het
Lpin3 T C 2: 160,905,340 Y829H probably damaging Het
Mocs3 C T 2: 168,231,190 R186C probably damaging Het
Olfr1105 T C 2: 87,033,595 T209A probably benign Het
Olfr121 T C 17: 37,752,703 F283S probably benign Het
Olfr1225 T A 2: 89,171,087 I42F probably benign Het
Olfr1344 C T 7: 6,440,400 R167C probably damaging Het
Osgepl1 A G 1: 53,323,213 I405V probably damaging Het
Pdcd11 T C 19: 47,102,666 S360P probably benign Het
Plekhs1 A G 19: 56,478,502 E255G probably damaging Het
Tex22 T A 12: 113,088,772 I150N probably benign Het
Tmem106a T C 11: 101,586,258 S98P probably benign Het
Tnfrsf18 A G 4: 156,028,366 T170A probably benign Het
Trpc6 C T 9: 8,653,034 P614S probably damaging Het
Usp28 C A 9: 49,035,932 P566Q probably damaging Het
Washc5 A G 15: 59,344,098 F811L possibly damaging Het
Other mutations in Il17b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0045:Il17b UTSW 18 61690244 missense probably damaging 0.99
R0100:Il17b UTSW 18 61690271 missense probably benign 0.09
R1375:Il17b UTSW 18 61690254 missense probably benign
R1468:Il17b UTSW 18 61690412 splice site probably null
R1468:Il17b UTSW 18 61690412 splice site probably null
R1517:Il17b UTSW 18 61690245 missense probably damaging 0.98
R2157:Il17b UTSW 18 61690368 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGCTTGGCTCTGGCCTTTGAC -3'
(R):5'- GGCAGACATTAAGAAGGCACCCATC -3'

Sequencing Primer
(F):5'- GCTCTGGCCTTTGACCAGTAG -3'
(R):5'- cagaactaatcaaccaacccaac -3'
Posted On2013-08-06