Mutagenetix > Incidental Mutation

Incidental Mutation 'R0104:Zfyve9'

64145

Institutional Source

Beutler Lab

Gene Symbol

Zfyve9

Ensembl Gene

ENSMUSG00000034557

Gene Name

zinc finger, FYVE domain containing 9

Synonyms

Madhip

MMRRC Submission

038390-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.399) question?

Stock #

R0104 (G1)

Quality Score

136

Status

Not validated

Chromosome

Chromosomal Location

108494663-108637995 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 108575360 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Tyrosine at position 574 (D574Y)

Ref Sequence

ENSEMBL: ENSMUSP00000102268 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042185] [ENSMUST00000106657] [ENSMUST00000106658] [ENSMUST00000178992]

AlphaFold

A2A8R0

Predicted Effect

probably benign
Transcript: ENSMUST00000042185

SMART Domains

Protein: ENSMUSP00000039852
Gene: ENSMUSG00000034557

Domain	Start	End	E-Value	Type
Blast:FYVE	7	40	4e-7	BLAST
Pfam:SARA	52	92	1e-25	PFAM
Pfam:DUF3480	328	681	1.4e-189	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000106657
AA Change: D574Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102268
Gene: ENSMUSG00000034557
AA Change: D574Y

Domain	Start	End	E-Value	Type
low complexity region	230	243	N/A	INTRINSIC
low complexity region	471	487	N/A	INTRINSIC
low complexity region	578	587	N/A	INTRINSIC
Blast:FYVE	590	618	7e-6	BLAST
FYVE	663	731	2.38e-26	SMART
Pfam:SARA	745	783	1.3e-22	PFAM
Pfam:DUF3480	1020	1372	1e-178	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000106658
AA Change: D574Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000102269
Gene: ENSMUSG00000034557
AA Change: D574Y

Domain	Start	End	E-Value	Type
low complexity region	230	243	N/A	INTRINSIC
low complexity region	471	487	N/A	INTRINSIC
low complexity region	578	587	N/A	INTRINSIC
Blast:FYVE	590	618	8e-6	BLAST
FYVE	663	731	2.38e-26	SMART
Pfam:DUF3480	960	1313	5.5e-189	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000178992

SMART Domains

Protein: ENSMUSP00000136370
Gene: ENSMUSG00000094958

Domain	Start	End	E-Value	Type
low complexity region	54	74	N/A	INTRINSIC
low complexity region	87	102	N/A	INTRINSIC
low complexity region	114	148	N/A	INTRINSIC

Meta Mutation Damage Score

0.1897

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a double zinc finger motif-containing protein that participates in the transforming growth factor-beta (TGFB) signalling pathway. The encoded protein interacts directly with SMAD2 and SMAD3, and recruits SMAD2 to the TGFB receptor. There are multiple pseudogenes for this gene on chromosomes 2, 15, and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]

Allele List at MGI

Other mutations in this stock

Total: 17 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Dnah5	A	T	15: 28,453,499 (GRCm39)	E4423D	possibly damaging	Het
Fsip2	A	T	2: 82,809,317 (GRCm39)	T1879S	possibly damaging	Het
Gm136	G	T	4: 34,746,593 (GRCm39)	H139Q	possibly damaging	Het
Ifrd2	T	A	9: 107,465,116 (GRCm39)	L10H	probably damaging	Het
Itpr3	C	A	17: 27,314,966 (GRCm39)	H704Q	probably benign	Het
Kcng1	A	G	2: 168,110,966 (GRCm39)	I66T	probably damaging	Het
Kcnv2	T	C	19: 27,300,619 (GRCm39)	Y157H	probably damaging	Het
Leng8	A	G	7: 4,146,807 (GRCm39)	D443G	probably damaging	Het
Mlst8	T	C	17: 24,695,091 (GRCm39)	N264S	possibly damaging	Het
Pcdhb8	A	G	18: 37,488,718 (GRCm39)	E132G	probably benign	Het
Pmpcb	C	G	5: 21,951,036 (GRCm39)	S266*	probably null	Het
Prmt7	T	C	8: 106,963,982 (GRCm39)	I292T	probably damaging	Het
Rif1	T	C	2: 52,000,104 (GRCm39)	L1186S	possibly damaging	Het
Sox30	A	C	11: 45,872,141 (GRCm39)	E332A	possibly damaging	Het
Taf2	T	C	15: 54,901,734 (GRCm39)	D820G	probably benign	Het
Tas2r120	T	A	6: 132,634,809 (GRCm39)		probably null	Het
Zfp655	T	C	5: 145,180,825 (GRCm39)	S228P	probably damaging	Het

Other mutations in Zfyve9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Zfyve9	APN	4	108,499,304 (GRCm39)	missense	possibly damaging	0.85
IGL01161:Zfyve9	APN	4	108,538,261 (GRCm39)	missense	probably damaging	1.00
IGL01404:Zfyve9	APN	4	108,539,348 (GRCm39)	missense	probably damaging	1.00
IGL01451:Zfyve9	APN	4	108,539,457 (GRCm39)	missense	probably damaging	0.98
IGL01655:Zfyve9	APN	4	108,499,289 (GRCm39)	missense	probably damaging	1.00
IGL02567:Zfyve9	APN	4	108,531,720 (GRCm39)	missense	probably damaging	1.00
IGL02593:Zfyve9	APN	4	108,539,420 (GRCm39)	missense	possibly damaging	0.73
IGL03169:Zfyve9	APN	4	108,553,022 (GRCm39)	missense	probably damaging	1.00
IGL03206:Zfyve9	APN	4	108,546,406 (GRCm39)	missense	possibly damaging	0.88
IGL03288:Zfyve9	APN	4	108,580,996 (GRCm39)	splice site	probably benign
R0008:Zfyve9	UTSW	4	108,575,902 (GRCm39)	missense	possibly damaging	0.92
R0008:Zfyve9	UTSW	4	108,575,902 (GRCm39)	missense	possibly damaging	0.92
R0104:Zfyve9	UTSW	4	108,575,360 (GRCm39)	missense	probably damaging	1.00
R0362:Zfyve9	UTSW	4	108,538,166 (GRCm39)	missense	probably damaging	0.96
R0502:Zfyve9	UTSW	4	108,576,961 (GRCm39)	nonsense	probably null
R0503:Zfyve9	UTSW	4	108,576,961 (GRCm39)	nonsense	probably null
R0557:Zfyve9	UTSW	4	108,531,708 (GRCm39)	missense	probably damaging	0.98
R0835:Zfyve9	UTSW	4	108,575,866 (GRCm39)	missense	probably damaging	0.99
R1215:Zfyve9	UTSW	4	108,507,426 (GRCm39)	missense	probably benign	0.32
R1245:Zfyve9	UTSW	4	108,550,508 (GRCm39)	intron	probably benign
R1527:Zfyve9	UTSW	4	108,552,964 (GRCm39)	critical splice donor site	probably null
R1638:Zfyve9	UTSW	4	108,542,104 (GRCm39)	critical splice donor site	probably null
R1653:Zfyve9	UTSW	4	108,517,774 (GRCm39)	nonsense	probably null
R1728:Zfyve9	UTSW	4	108,575,698 (GRCm39)	missense	possibly damaging	0.80
R1729:Zfyve9	UTSW	4	108,575,698 (GRCm39)	missense	possibly damaging	0.80
R1861:Zfyve9	UTSW	4	108,539,492 (GRCm39)	splice site	probably benign
R1983:Zfyve9	UTSW	4	108,546,386 (GRCm39)	missense	possibly damaging	0.94
R2050:Zfyve9	UTSW	4	108,576,500 (GRCm39)	missense	possibly damaging	0.94
R2050:Zfyve9	UTSW	4	108,575,800 (GRCm39)	missense	probably benign	0.05
R2246:Zfyve9	UTSW	4	108,546,461 (GRCm39)	missense	possibly damaging	0.70
R2338:Zfyve9	UTSW	4	108,517,811 (GRCm39)	missense	probably damaging	1.00
R2697:Zfyve9	UTSW	4	108,553,016 (GRCm39)	missense	probably damaging	0.99
R3522:Zfyve9	UTSW	4	108,576,940 (GRCm39)	missense	probably benign	0.45
R4030:Zfyve9	UTSW	4	108,576,898 (GRCm39)	missense	possibly damaging	0.61
R4247:Zfyve9	UTSW	4	108,576,389 (GRCm39)	missense	probably benign	0.28
R4273:Zfyve9	UTSW	4	108,538,173 (GRCm39)	missense	probably damaging	1.00
R4720:Zfyve9	UTSW	4	108,501,565 (GRCm39)	missense	possibly damaging	0.94
R4835:Zfyve9	UTSW	4	108,575,195 (GRCm39)	missense	possibly damaging	0.70
R4871:Zfyve9	UTSW	4	108,538,183 (GRCm39)	missense	probably damaging	1.00
R4881:Zfyve9	UTSW	4	108,584,688 (GRCm39)	splice site	probably null
R4974:Zfyve9	UTSW	4	108,538,097 (GRCm39)	critical splice donor site	probably null
R5024:Zfyve9	UTSW	4	108,548,866 (GRCm39)	missense	probably benign	0.18
R5481:Zfyve9	UTSW	4	108,501,546 (GRCm39)	missense	probably damaging	1.00
R5660:Zfyve9	UTSW	4	108,576,365 (GRCm39)	missense	probably benign
R5965:Zfyve9	UTSW	4	108,548,878 (GRCm39)	missense	possibly damaging	0.53
R5996:Zfyve9	UTSW	4	108,576,557 (GRCm39)	missense	probably benign	0.07
R6315:Zfyve9	UTSW	4	108,531,685 (GRCm39)	missense	probably damaging	1.00
R6772:Zfyve9	UTSW	4	108,496,466 (GRCm39)	missense	probably damaging	1.00
R6865:Zfyve9	UTSW	4	108,501,558 (GRCm39)	missense	possibly damaging	0.71
R7112:Zfyve9	UTSW	4	108,507,519 (GRCm39)	missense	probably benign	0.00
R7258:Zfyve9	UTSW	4	108,514,151 (GRCm39)	missense	possibly damaging	0.94
R7266:Zfyve9	UTSW	4	108,575,744 (GRCm39)	missense	possibly damaging	0.62
R7287:Zfyve9	UTSW	4	108,575,453 (GRCm39)	missense	probably benign	0.00
R7356:Zfyve9	UTSW	4	108,576,212 (GRCm39)	missense	probably benign	0.01
R7389:Zfyve9	UTSW	4	108,550,515 (GRCm39)	critical splice donor site	probably null
R7729:Zfyve9	UTSW	4	108,548,973 (GRCm39)	missense	probably benign	0.01
R7780:Zfyve9	UTSW	4	108,576,298 (GRCm39)	missense	possibly damaging	0.81
R7801:Zfyve9	UTSW	4	108,542,192 (GRCm39)	missense	possibly damaging	0.50
R8069:Zfyve9	UTSW	4	108,542,215 (GRCm39)	missense	probably benign	0.32
R8201:Zfyve9	UTSW	4	108,507,474 (GRCm39)	missense	possibly damaging	0.83
R8221:Zfyve9	UTSW	4	108,576,877 (GRCm39)	missense	possibly damaging	0.77
R8682:Zfyve9	UTSW	4	108,576,539 (GRCm39)	missense	probably benign	0.30
R8948:Zfyve9	UTSW	4	108,499,288 (GRCm39)	missense	possibly damaging	0.84
R8960:Zfyve9	UTSW	4	108,501,558 (GRCm39)	missense	possibly damaging	0.71
R9123:Zfyve9	UTSW	4	108,575,760 (GRCm39)	missense	probably benign	0.30
R9135:Zfyve9	UTSW	4	108,539,386 (GRCm39)	nonsense	probably null
R9439:Zfyve9	UTSW	4	108,501,538 (GRCm39)	missense	probably benign	0.33
R9449:Zfyve9	UTSW	4	108,576,435 (GRCm39)	missense	probably damaging	1.00
R9560:Zfyve9	UTSW	4	108,575,334 (GRCm39)	missense	possibly damaging	0.82
R9603:Zfyve9	UTSW	4	108,499,288 (GRCm39)	missense	possibly damaging	0.84
R9657:Zfyve9	UTSW	4	108,575,729 (GRCm39)	missense	probably damaging	1.00
R9691:Zfyve9	UTSW	4	108,576,305 (GRCm39)	missense	probably benign
R9717:Zfyve9	UTSW	4	108,539,334 (GRCm39)	missense	probably benign	0.11
Z1176:Zfyve9	UTSW	4	108,499,404 (GRCm39)	missense	possibly damaging	0.85

Predicted Primers

PCR Primer
(F):5'- AGTGCAAGGCATGGTCTACTGGAG -3'
(R):5'- CACTGTTAATGATGCACCAGCAGC -3'

Sequencing Primer
(F):5'- TGCGTTGACTGCTGAGTTCT -3'
(R):5'- TTCCTATGGAATGCAGAGCC -3'

Posted On

2013-08-06