Incidental Mutation 'R0109:Col19a1'
ID64179
Institutional Source Beutler Lab
Gene Symbol Col19a1
Ensembl Gene ENSMUSG00000026141
Gene Namecollagen, type XIX, alpha 1
Synonyms
MMRRC Submission 038395-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0109 (G1)
Quality Score113
Status Not validated
Chromosome1
Chromosomal Location24261890-24587472 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to C at 24559768 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051344] [ENSMUST00000115244]
Predicted Effect probably null
Transcript: ENSMUST00000051344
SMART Domains Protein: ENSMUSP00000052606
Gene: ENSMUSG00000026141

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 47 231 1.61e-63 SMART
low complexity region 254 266 N/A INTRINSIC
Pfam:Collagen 288 349 1e-9 PFAM
Pfam:Collagen 325 391 2.2e-10 PFAM
Pfam:Collagen 376 442 1.4e-8 PFAM
Pfam:Collagen 436 500 2.9e-9 PFAM
Pfam:Collagen 474 536 6.3e-10 PFAM
Pfam:Collagen 519 579 5.6e-10 PFAM
Pfam:Collagen 559 620 1.2e-8 PFAM
Pfam:Collagen 619 675 8.7e-11 PFAM
Pfam:Collagen 697 774 2.4e-8 PFAM
Pfam:Collagen 753 819 8.7e-10 PFAM
Pfam:Collagen 831 892 8.8e-12 PFAM
internal_repeat_2 905 943 3.52e-11 PROSPERO
internal_repeat_1 905 980 8.61e-26 PROSPERO
internal_repeat_2 947 982 3.52e-11 PROSPERO
low complexity region 983 1003 N/A INTRINSIC
low complexity region 1030 1042 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115244
SMART Domains Protein: ENSMUSP00000110899
Gene: ENSMUSG00000026141

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 47 231 1.61e-63 SMART
low complexity region 254 266 N/A INTRINSIC
Pfam:Collagen 288 347 3.1e-9 PFAM
Pfam:Collagen 330 391 1.1e-9 PFAM
internal_repeat_4 455 492 1.88e-5 PROSPERO
Pfam:Collagen 519 579 2e-9 PFAM
Pfam:Collagen 559 620 4.9e-8 PFAM
Pfam:Collagen 619 675 3.5e-10 PFAM
low complexity region 723 741 N/A INTRINSIC
Pfam:Collagen 753 819 2.8e-9 PFAM
Pfam:Collagen 831 892 3.9e-11 PFAM
internal_repeat_2 905 943 1.18e-11 PROSPERO
internal_repeat_1 905 980 8.89e-27 PROSPERO
internal_repeat_2 947 982 1.18e-11 PROSPERO
low complexity region 983 1003 N/A INTRINSIC
low complexity region 1048 1069 N/A INTRINSIC
low complexity region 1078 1115 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XIX collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Although the function of this collagen is not known, other members of this collagen family are found in association with fibril-forming collagens such as type I and II, and serve to maintain the integrity of the extracellular matrix. The transcript produced from this gene has an unusually large 3' UTR which has not been completely sequenced. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display postnatal lethality resulting from impaired swallowing, abnormal esophageal muscle development, and impaired muscle relaxation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,318,762 K1496* probably null Het
Anapc1 C A 2: 128,634,693 R1335L probably damaging Het
Arhgef10l A T 4: 140,578,294 S203T probably benign Het
Astn1 C T 1: 158,664,104 T41I possibly damaging Het
Avil A G 10: 127,013,644 N603S probably benign Het
Brca1 T C 11: 101,531,090 D149G possibly damaging Het
Cps1 T C 1: 67,229,418 V1435A possibly damaging Het
Cyp2j6 A T 4: 96,518,157 I459N probably damaging Het
Cyth1 T C 11: 118,182,306 E242G probably damaging Het
Dclk3 T G 9: 111,467,670 L94R possibly damaging Het
Dsg3 T C 18: 20,540,134 V954A probably damaging Het
Dync2h1 T A 9: 7,111,487 D309V probably damaging Het
Efhd2 A G 4: 141,874,567 F101L probably benign Het
Fgd5 T A 6: 91,988,235 M325K possibly damaging Het
Fras1 T C 5: 96,710,077 S2077P probably benign Het
Frmpd1 A T 4: 45,279,340 E688D probably benign Het
Hspg2 T C 4: 137,562,201 V3824A probably benign Het
Kctd16 A G 18: 40,259,151 E264G probably benign Het
Mapk15 A T 15: 75,996,077 K153* probably null Het
Miox G A 15: 89,335,581 V91I probably benign Het
Nfyb G A 10: 82,755,002 A65V possibly damaging Het
Olfr1241 A G 2: 89,482,803 F111L probably benign Het
Olfr1442 C A 19: 12,674,860 F218L probably benign Het
Olfr646 T C 7: 104,106,605 S109P probably damaging Het
Parp9 T C 16: 35,948,341 I64T probably damaging Het
Pfkfb4 T C 9: 108,998,889 V43A probably benign Het
Pgap1 A T 1: 54,494,825 V643E probably damaging Het
Pip5k1b T A 19: 24,379,047 M176L probably benign Het
Ppfia4 A T 1: 134,324,217 probably null Het
Prdx2 G A 8: 84,970,251 G4S probably benign Het
Rin3 A G 12: 102,313,081 I50V possibly damaging Het
Rtl1 G A 12: 109,595,407 probably benign Het
Sgsm3 G C 15: 81,009,466 D434H probably damaging Het
Shank2 T C 7: 144,410,577 S634P possibly damaging Het
Sik2 A G 9: 50,899,475 M447T possibly damaging Het
Sla2 A G 2: 156,883,587 probably null Het
Spata16 T A 3: 26,913,267 F389I probably damaging Het
Srebf1 G A 11: 60,201,804 A793V probably benign Het
Tmed11 T A 5: 108,777,412 D178V probably damaging Het
Traf7 A G 17: 24,513,926 F110L probably benign Het
Ttn T A 2: 76,725,564 I30366F probably damaging Het
Ubqlnl C T 7: 104,150,192 V33M probably damaging Het
Vmn1r194 A G 13: 22,245,047 Y278C probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r114 A T 17: 23,310,575 Y184* probably null Het
Vmn2r53 C T 7: 12,582,066 A609T probably damaging Het
Vps13b A G 15: 35,572,119 T961A probably benign Het
Xirp2 T A 2: 67,519,278 N3272K probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp454 T A 11: 50,883,775 T24S possibly damaging Het
Other mutations in Col19a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Col19a1 APN 1 24561306 missense unknown
IGL00514:Col19a1 APN 1 24536932 missense unknown
IGL00756:Col19a1 APN 1 24322942 missense possibly damaging 0.85
IGL01408:Col19a1 APN 1 24306250 splice site probably benign
IGL01608:Col19a1 APN 1 24282545 missense probably damaging 1.00
IGL01664:Col19a1 APN 1 24561335 missense unknown
IGL01906:Col19a1 APN 1 24317429 missense probably damaging 1.00
IGL01916:Col19a1 APN 1 24534241 missense unknown
IGL02040:Col19a1 APN 1 24312045 critical splice donor site probably null
IGL02407:Col19a1 APN 1 24312372 splice site probably null
IGL02505:Col19a1 APN 1 24300584 splice site probably benign
IGL02606:Col19a1 APN 1 24534116 nonsense probably null
IGL02659:Col19a1 APN 1 24534034 missense unknown
IGL02815:Col19a1 APN 1 24285251 splice site probably null
IGL02880:Col19a1 APN 1 24325973 splice site probably benign
IGL02897:Col19a1 APN 1 24534098 missense unknown
IGL03102:Col19a1 APN 1 24328053 missense probably damaging 1.00
R0038:Col19a1 UTSW 1 24559744 missense unknown
R0124:Col19a1 UTSW 1 24526458 missense unknown
R0326:Col19a1 UTSW 1 24285051 critical splice donor site probably null
R0390:Col19a1 UTSW 1 24289655 splice site probably benign
R0675:Col19a1 UTSW 1 24575455 start gained probably benign
R0826:Col19a1 UTSW 1 24526386 missense unknown
R0948:Col19a1 UTSW 1 24296801 missense probably damaging 0.98
R1014:Col19a1 UTSW 1 24301273 critical splice donor site probably null
R1619:Col19a1 UTSW 1 24534091 missense unknown
R1691:Col19a1 UTSW 1 24536941 missense unknown
R1878:Col19a1 UTSW 1 24317395 missense probably benign 0.40
R1901:Col19a1 UTSW 1 24536997 missense unknown
R1928:Col19a1 UTSW 1 24451754 splice site probably benign
R1940:Col19a1 UTSW 1 24264750 nonsense probably null
R2015:Col19a1 UTSW 1 24559753 missense unknown
R2571:Col19a1 UTSW 1 24374631 missense unknown
R2844:Col19a1 UTSW 1 24559681 missense unknown
R2845:Col19a1 UTSW 1 24559681 missense unknown
R3107:Col19a1 UTSW 1 24337936 missense possibly damaging 0.71
R3861:Col19a1 UTSW 1 24326017 missense probably damaging 1.00
R3872:Col19a1 UTSW 1 24575327 splice site probably benign
R4180:Col19a1 UTSW 1 24270392 missense probably damaging 1.00
R4195:Col19a1 UTSW 1 24534052 missense unknown
R4196:Col19a1 UTSW 1 24534052 missense unknown
R4234:Col19a1 UTSW 1 24315395 splice site probably null
R4250:Col19a1 UTSW 1 24525645 missense unknown
R4396:Col19a1 UTSW 1 24510866 missense unknown
R4405:Col19a1 UTSW 1 24534109 missense unknown
R4450:Col19a1 UTSW 1 24322035 missense probably damaging 0.96
R4583:Col19a1 UTSW 1 24561329 missense unknown
R4980:Col19a1 UTSW 1 24526483 missense unknown
R5222:Col19a1 UTSW 1 24559640 splice site probably null
R5407:Col19a1 UTSW 1 24303494 missense probably damaging 0.99
R5439:Col19a1 UTSW 1 24293112 missense probably damaging 1.00
R5739:Col19a1 UTSW 1 24337915 missense probably damaging 1.00
R5740:Col19a1 UTSW 1 24337915 missense probably damaging 1.00
R5891:Col19a1 UTSW 1 24289725 missense probably damaging 1.00
R5996:Col19a1 UTSW 1 24328071 missense probably damaging 1.00
R6074:Col19a1 UTSW 1 24526483 missense unknown
R6152:Col19a1 UTSW 1 24374621 missense unknown
R6191:Col19a1 UTSW 1 24317393 missense probably damaging 1.00
R6236:Col19a1 UTSW 1 24279949 missense probably damaging 1.00
R6315:Col19a1 UTSW 1 24526452 missense unknown
R6709:Col19a1 UTSW 1 24282496 missense probably damaging 1.00
R6748:Col19a1 UTSW 1 24534070 missense unknown
R7098:Col19a1 UTSW 1 24526474 missense unknown
R7114:Col19a1 UTSW 1 24337936 missense possibly damaging 0.71
R7292:Col19a1 UTSW 1 24530008 missense unknown
R7392:Col19a1 UTSW 1 24534034 missense unknown
R7478:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
R7480:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
R7481:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
R7512:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
Z1088:Col19a1 UTSW 1 24279940 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACCCAAGGGTAAGCTGTTATTG -3'
(R):5'- TGGAACACATTTGCTGATTTCAAACAGG -3'

Sequencing Primer
(F):5'- ACAGCTTTGGGGTACACTAC -3'
(R):5'- TCAATCAACCTGTGGATATGGAT -3'
Posted On2013-08-06