Incidental Mutation 'R0048:Mroh9'
ID64241
Institutional Source Beutler Lab
Gene Symbol Mroh9
Ensembl Gene ENSMUSG00000071890
Gene Namemaestro heat-like repeat family member 9
Synonyms4921528O07Rik, Armc11
MMRRC Submission 038342-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0048 (G1)
Quality Score84
Status Validated
Chromosome1
Chromosomal Location163024302-163085670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 163062487 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 227 (T227M)
Ref Sequence ENSEMBL: ENSMUSP00000094365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096608]
Predicted Effect probably damaging
Transcript: ENSMUST00000096608
AA Change: T227M

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000094365
Gene: ENSMUSG00000071890
AA Change: T227M

DomainStartEndE-ValueType
SCOP:d1gw5b_ 231 716 2e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195132
Meta Mutation Damage Score 0.0252 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.3%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A G 1: 25,101,482 I299T probably benign Het
Ankrd12 A G 17: 65,984,803 S1212P probably damaging Het
Ankrd50 A G 3: 38,483,049 S52P probably benign Het
Brca1 A G 11: 101,524,977 V777A possibly damaging Het
Dppa2 A G 16: 48,317,398 M248V probably benign Het
Fat2 G T 11: 55,310,039 H736Q probably benign Het
Fgfr2 A T 7: 130,180,488 probably benign Het
Gif G A 19: 11,749,756 V110M possibly damaging Het
Hmcn2 T C 2: 31,428,237 S3865P possibly damaging Het
Iqgap3 A T 3: 88,115,949 T516S probably benign Het
Itpr2 T C 6: 146,232,291 probably null Het
Lrrfip1 C T 1: 91,093,647 probably benign Het
Mfsd12 G A 10: 81,362,814 V380I possibly damaging Het
Mtor C T 4: 148,538,881 Q2063* probably null Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Olfr273 C A 4: 52,856,196 A106S probably damaging Het
Ptgfr A G 3: 151,835,091 V260A possibly damaging Het
Raph1 T C 1: 60,500,605 K423E probably benign Het
Rbm27 A G 18: 42,298,464 D112G probably benign Het
Ryr2 T C 13: 11,595,784 E4052G probably damaging Het
Sart3 G T 5: 113,755,397 D346E possibly damaging Het
Siglec1 T C 2: 131,073,397 T1425A possibly damaging Het
Snx25 A T 8: 46,105,109 probably benign Het
Son T A 16: 91,658,977 H1537Q possibly damaging Het
Tgfb1 T A 7: 25,694,354 probably benign Het
Umodl1 A T 17: 30,968,477 N172Y probably damaging Het
Urah C T 7: 140,836,752 T46I probably damaging Het
Usp8 C T 2: 126,737,889 P353L probably damaging Het
Vamp2 A G 11: 69,089,759 D51G possibly damaging Het
Vmn1r67 G A 7: 10,446,866 G19E probably damaging Het
Wdr76 C T 2: 121,535,419 probably benign Het
Wwox C A 8: 114,439,830 P20Q probably damaging Het
Other mutations in Mroh9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Mroh9 APN 1 163045781 missense possibly damaging 0.89
IGL00705:Mroh9 APN 1 163079503 missense probably damaging 1.00
IGL00788:Mroh9 APN 1 163024658 missense probably benign 0.06
IGL00795:Mroh9 APN 1 163060622 missense probably damaging 1.00
IGL00815:Mroh9 APN 1 163039131 missense probably damaging 1.00
IGL01025:Mroh9 APN 1 163047866 missense possibly damaging 0.67
IGL01303:Mroh9 APN 1 163080575 missense probably benign 0.00
IGL01526:Mroh9 APN 1 163055603 missense probably damaging 0.99
IGL01680:Mroh9 APN 1 163047982 splice site probably null
IGL01823:Mroh9 APN 1 163055609 missense probably benign 0.39
IGL02024:Mroh9 APN 1 163062502 missense possibly damaging 0.65
IGL02213:Mroh9 APN 1 163058079 missense probably damaging 1.00
IGL02455:Mroh9 APN 1 163075580 missense probably benign 0.03
IGL02546:Mroh9 APN 1 163080576 missense probably benign 0.04
IGL03059:Mroh9 APN 1 163024636 missense possibly damaging 0.95
IGL03061:Mroh9 APN 1 163026502 missense probably damaging 1.00
IGL03071:Mroh9 APN 1 163039197 missense probably damaging 1.00
R0048:Mroh9 UTSW 1 163062487 missense probably damaging 0.97
R0441:Mroh9 UTSW 1 163060762 missense probably damaging 1.00
R0506:Mroh9 UTSW 1 163060636 missense possibly damaging 0.90
R0629:Mroh9 UTSW 1 163060636 missense possibly damaging 0.90
R0751:Mroh9 UTSW 1 163066124 missense possibly damaging 0.84
R1301:Mroh9 UTSW 1 163043983 critical splice donor site probably null
R1481:Mroh9 UTSW 1 163026509 missense probably damaging 1.00
R1618:Mroh9 UTSW 1 163024541 missense probably benign 0.00
R1647:Mroh9 UTSW 1 163046056 missense probably damaging 1.00
R1648:Mroh9 UTSW 1 163046056 missense probably damaging 1.00
R1668:Mroh9 UTSW 1 163024592 missense possibly damaging 0.52
R1795:Mroh9 UTSW 1 163056778 missense probably damaging 0.97
R1796:Mroh9 UTSW 1 163045710 missense probably damaging 1.00
R1857:Mroh9 UTSW 1 163039145 missense probably damaging 0.98
R1869:Mroh9 UTSW 1 163026513 missense probably damaging 0.97
R1923:Mroh9 UTSW 1 163076291 missense probably damaging 1.00
R2325:Mroh9 UTSW 1 163026530 splice site probably null
R2511:Mroh9 UTSW 1 163038945 missense probably benign 0.13
R2912:Mroh9 UTSW 1 163044003 missense probably damaging 1.00
R2913:Mroh9 UTSW 1 163044003 missense probably damaging 1.00
R2919:Mroh9 UTSW 1 163056772 missense probably damaging 1.00
R2973:Mroh9 UTSW 1 163056769 missense probably damaging 1.00
R3912:Mroh9 UTSW 1 163066069 missense probably damaging 0.97
R4034:Mroh9 UTSW 1 163080553 critical splice donor site probably null
R4551:Mroh9 UTSW 1 163044093 missense probably damaging 0.98
R4656:Mroh9 UTSW 1 163066024 missense probably damaging 1.00
R4662:Mroh9 UTSW 1 163055593 missense probably damaging 0.97
R4743:Mroh9 UTSW 1 163024492 missense probably benign 0.05
R4890:Mroh9 UTSW 1 163026524 missense probably damaging 1.00
R5128:Mroh9 UTSW 1 163060760 missense probably damaging 1.00
R5129:Mroh9 UTSW 1 163060760 missense probably damaging 1.00
R5147:Mroh9 UTSW 1 163060760 missense probably damaging 1.00
R5157:Mroh9 UTSW 1 163044121 missense probably damaging 0.96
R5324:Mroh9 UTSW 1 163060760 missense probably damaging 1.00
R5325:Mroh9 UTSW 1 163060760 missense probably damaging 1.00
R5340:Mroh9 UTSW 1 163080587 start gained probably benign
R6005:Mroh9 UTSW 1 163075677 missense probably damaging 0.99
R6182:Mroh9 UTSW 1 163066043 nonsense probably null
R6414:Mroh9 UTSW 1 163074702 missense probably damaging 1.00
R6477:Mroh9 UTSW 1 163076304 missense probably damaging 1.00
R6540:Mroh9 UTSW 1 163038972 missense possibly damaging 0.87
R6541:Mroh9 UTSW 1 163058038 missense possibly damaging 0.78
R6643:Mroh9 UTSW 1 163075561 missense probably damaging 1.00
R6811:Mroh9 UTSW 1 163046041 missense possibly damaging 0.86
R6830:Mroh9 UTSW 1 163076366 missense probably benign
R7026:Mroh9 UTSW 1 163060682 missense probably benign 0.00
R7052:Mroh9 UTSW 1 163038956 missense possibly damaging 0.92
R7068:Mroh9 UTSW 1 163039181 missense probably damaging 1.00
R7350:Mroh9 UTSW 1 163076289 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTAAGGCTTGACAGCACATCCTGTAAA -3'
(R):5'- GGTAGGAAACTGGAAGTACCAGCATCT -3'

Sequencing Primer
(F):5'- ataggcatgtataagtatgTGAAGGC -3'
(R):5'- GAAGTACCAGCATCTTCTGTGAC -3'
Posted On2013-08-06