Incidental Mutation 'R0050:Dock9'
ID64263
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Namededicator of cytokinesis 9
SynonymsD14Wsu89e, Zizimin1, B230309H04Rik
MMRRC Submission 038344-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0050 (G1)
Quality Score137
Status Validated
Chromosome14
Chromosomal Location121542046-121797837 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121607225 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1124 (V1124A)
Ref Sequence ENSEMBL: ENSMUSP00000148328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212376] [ENSMUST00000212416]
Predicted Effect probably benign
Transcript: ENSMUST00000040700
AA Change: V1110A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558
AA Change: V1110A

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100299
AA Change: V1112A

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558
AA Change: V1112A

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212181
AA Change: V1110A

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000212376
AA Change: V1124A

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000212416
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 C T 11: 110,145,591 C564Y probably damaging Het
Adamts2 T C 11: 50,775,395 V406A probably damaging Het
Ankar T A 1: 72,656,164 E1093D probably damaging Het
Arhgef38 C A 3: 133,132,196 D75Y probably damaging Het
Atg4b T A 1: 93,787,718 probably benign Het
Cadm2 A G 16: 66,953,266 probably benign Het
Ces2c T A 8: 104,848,199 M96K probably benign Het
Dmrt3 C A 19: 25,622,589 P266H probably damaging Het
Edem1 T C 6: 108,828,848 F37L possibly damaging Het
Ermp1 C A 19: 29,628,784 A190S probably damaging Het
Gm10267 T A 18: 44,156,453 probably benign Het
Gm11492 T C 11: 87,567,346 L182S probably damaging Het
Golga2 T A 2: 32,292,127 V29D probably damaging Het
Gprc6a T A 10: 51,615,389 M755L probably damaging Het
H1foo G T 6: 115,947,768 K78N probably damaging Het
Lama3 T A 18: 12,404,103 H268Q probably damaging Het
Lrriq1 A G 10: 103,068,931 V1614A probably damaging Het
Oaz2 A G 9: 65,687,802 E61G probably damaging Het
Pear1 G T 3: 87,755,987 Y441* probably null Het
Pkhd1l1 A T 15: 44,573,807 T3493S possibly damaging Het
Plekhg5 T C 4: 152,108,088 probably null Het
Ppp3cb A G 14: 20,531,752 V65A possibly damaging Het
Rheb A T 5: 24,817,834 probably benign Het
Ros1 G A 10: 52,101,803 T1449M probably damaging Het
Slc6a12 T C 6: 121,360,419 probably benign Het
Stx2 A G 5: 128,999,508 probably null Het
Tnxb T A 17: 34,673,325 D764E probably damaging Het
Trmt2a A T 16: 18,250,843 E234D probably damaging Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121668468 missense probably benign 0.12
IGL00817:Dock9 APN 14 121698291 missense probably damaging 0.96
IGL00923:Dock9 APN 14 121607092 unclassified probably benign
IGL01385:Dock9 APN 14 121580583 missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121653084 missense probably damaging 1.00
IGL01767:Dock9 APN 14 121622870 missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121559028 missense probably damaging 1.00
IGL02512:Dock9 APN 14 121619538 splice site probably benign
IGL02525:Dock9 APN 14 121640126 missense probably damaging 1.00
IGL02550:Dock9 APN 14 121698312 start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121625147 splice site probably benign
IGL02666:Dock9 APN 14 121580699 missense probably benign 0.42
IGL02674:Dock9 APN 14 121595611 splice site probably null
IGL02795:Dock9 APN 14 121639978 missense probably benign 0.04
IGL03074:Dock9 APN 14 121607270 missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121639528 missense probably damaging 1.00
IGL03294:Dock9 APN 14 121641623 splice site probably benign
R0036:Dock9 UTSW 14 121622853 missense probably damaging 1.00
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0270:Dock9 UTSW 14 121575999 missense probably benign 0.02
R0494:Dock9 UTSW 14 121662584 missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121651768 nonsense probably null
R1029:Dock9 UTSW 14 121599684 splice site probably null
R1214:Dock9 UTSW 14 121586316 missense probably benign 0.02
R1231:Dock9 UTSW 14 121575950 missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121546064 missense probably damaging 1.00
R1629:Dock9 UTSW 14 121543574 missense possibly damaging 0.88
R1637:Dock9 UTSW 14 121651775 missense possibly damaging 0.66
R1733:Dock9 UTSW 14 121626880 missense probably benign 0.01
R1772:Dock9 UTSW 14 121609798 missense probably benign 0.07
R1855:Dock9 UTSW 14 121640159 missense probably damaging 1.00
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1901:Dock9 UTSW 14 121625153 splice site probably null
R1920:Dock9 UTSW 14 121583380 missense probably damaging 1.00
R1987:Dock9 UTSW 14 121591830 missense probably benign 0.00
R3035:Dock9 UTSW 14 121606837 missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121629086 splice site probably null
R4020:Dock9 UTSW 14 121606855 missense probably benign 0.00
R4021:Dock9 UTSW 14 121626912 missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121583471 missense probably damaging 1.00
R4258:Dock9 UTSW 14 121581442 missense probably benign 0.00
R4423:Dock9 UTSW 14 121562053 critical splice donor site probably null
R4561:Dock9 UTSW 14 121559007 missense probably benign 0.01
R4604:Dock9 UTSW 14 121668459 missense probably damaging 1.00
R4646:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4647:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4776:Dock9 UTSW 14 121610097 missense possibly damaging 0.81
R4809:Dock9 UTSW 14 121546596 missense probably benign 0.37
R4865:Dock9 UTSW 14 121543505 makesense probably null
R4951:Dock9 UTSW 14 121653135 missense probably benign 0.35
R5151:Dock9 UTSW 14 121578170 missense probably damaging 1.00
R5359:Dock9 UTSW 14 121653060 missense possibly damaging 0.69
R5366:Dock9 UTSW 14 121578203 missense probably damaging 1.00
R5502:Dock9 UTSW 14 121610182 splice site probably null
R5579:Dock9 UTSW 14 121599695 missense probably damaging 1.00
R5753:Dock9 UTSW 14 121634625 missense probably benign 0.05
R5836:Dock9 UTSW 14 121681351 missense probably damaging 1.00
R5858:Dock9 UTSW 14 121628792 missense probably benign 0.00
R5890:Dock9 UTSW 14 121668408 critical splice donor site probably null
R6075:Dock9 UTSW 14 121545973 missense probably benign
R6298:Dock9 UTSW 14 121634594 missense probably damaging 1.00
R6306:Dock9 UTSW 14 121562080 missense probably damaging 1.00
R6321:Dock9 UTSW 14 121546021 missense probably damaging 1.00
R6330:Dock9 UTSW 14 121605243 start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121610027 missense probably damaging 1.00
R6784:Dock9 UTSW 14 121543514 missense probably damaging 1.00
R6826:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6830:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6838:Dock9 UTSW 14 121546596 missense possibly damaging 0.71
R6868:Dock9 UTSW 14 121586264 missense probably benign 0.37
R6919:Dock9 UTSW 14 121643152 missense probably benign 0.42
R6989:Dock9 UTSW 14 121627379 missense probably damaging 1.00
Z1088:Dock9 UTSW 14 121555275 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACGTTGATCCGCTGGACATTTTC -3'
(R):5'- AGTTTTGTCACCTGTAGCCACACAC -3'

Sequencing Primer
(F):5'- ACACATGGTAAGTGTGTTCCC -3'
(R):5'- TGTAGCCACACACGAGGTG -3'
Posted On2013-08-06