Incidental Mutation 'R0051:Cfap46'
ID64293
Institutional Source Beutler Lab
Gene Symbol Cfap46
Ensembl Gene ENSMUSG00000049571
Gene Namecilia and flagella associated protein 46
Synonyms9330101J02Rik
MMRRC Submission 038345-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0051 (G1)
Quality Score193
Status Validated
Chromosome7
Chromosomal Location139600951-139683817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139676035 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 300 (C300R)
Ref Sequence ENSEMBL: ENSMUSP00000120186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129990] [ENSMUST00000130453] [ENSMUST00000140820]
Predicted Effect probably damaging
Transcript: ENSMUST00000129990
AA Change: C300R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120186
Gene: ENSMUSG00000049571
AA Change: C300R

DomainStartEndE-ValueType
Blast:TPR 175 207 7e-11 BLAST
Blast:TPR 426 459 1e-11 BLAST
low complexity region 868 879 N/A INTRINSIC
Blast:TPR 936 969 2e-7 BLAST
Blast:TPR 1112 1145 1e-9 BLAST
coiled coil region 1347 1423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130453
AA Change: C204R

PolyPhen 2 Score 0.407 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000115437
Gene: ENSMUSG00000049571
AA Change: C204R

DomainStartEndE-ValueType
Blast:TPR 116 149 1e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138129
Predicted Effect possibly damaging
Transcript: ENSMUST00000140820
AA Change: C300R

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121085
Gene: ENSMUSG00000049571
AA Change: C300R

DomainStartEndE-ValueType
Blast:TPR 175 208 5e-11 BLAST
Blast:TPR 426 459 8e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156116
Meta Mutation Damage Score 0.0268 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,579,101 noncoding transcript Het
Abr T A 11: 76,472,502 Q163L probably benign Het
AI314180 A G 4: 58,832,729 L877S probably damaging Het
Ankrd11 C A 8: 122,889,742 C2457F probably damaging Het
Anks3 G C 16: 4,947,749 T163S probably benign Het
Cacna1d G A 14: 30,111,095 P908S probably damaging Het
Ccdc146 C A 5: 21,316,904 R374L possibly damaging Het
Cdc45 G T 16: 18,794,774 A348E probably damaging Het
Coq2 T C 5: 100,663,685 N146S probably benign Het
Dalrd3 T C 9: 108,572,215 V120A possibly damaging Het
Dcp2 T A 18: 44,405,374 probably benign Het
Ddx39 A G 8: 83,720,622 K137R possibly damaging Het
Diaph3 A G 14: 87,037,454 probably null Het
Dmbt1 G T 7: 131,119,496 R1668L possibly damaging Het
Dnah7a T G 1: 53,521,086 probably benign Het
Dpp7 A G 2: 25,356,095 Y49H possibly damaging Het
Drd5 A G 5: 38,320,614 S317G probably benign Het
Ecsit C T 9: 22,076,288 V152I probably benign Het
Emc1 T A 4: 139,375,163 M923K possibly damaging Het
Fam102a G A 2: 32,558,053 R58Q possibly damaging Het
Fcrl6 A T 1: 172,598,753 L159Q probably benign Het
Frrs1 T C 3: 116,885,297 probably benign Het
Hspd1 A G 1: 55,082,046 probably benign Het
Impg2 T A 16: 56,258,048 S458T probably damaging Het
Klf17 T C 4: 117,760,392 Y256C probably damaging Het
Lnx2 A G 5: 147,029,353 F319L probably damaging Het
Mafg G T 11: 120,629,604 R57S probably damaging Het
Med13l T A 5: 118,742,655 W1271R probably damaging Het
Mrgprb1 A G 7: 48,447,214 S24P probably benign Het
Mtrf1l T C 10: 5,813,384 E315G probably damaging Het
Naip1 T C 13: 100,411,001 E1239G probably damaging Het
Ncaph2 T C 15: 89,369,664 S320P probably damaging Het
Nek11 A G 9: 105,218,539 probably benign Het
Nlrp2 A T 7: 5,322,334 probably benign Het
Odf3 C A 7: 140,850,221 probably benign Het
Rbm26 A C 14: 105,152,540 V216G possibly damaging Het
Rnf115 A G 3: 96,785,022 D178G probably damaging Het
Rtel1 C T 2: 181,350,656 Q424* probably null Het
Rwdd4a A G 8: 47,537,365 probably benign Het
Ryr3 T C 2: 112,869,075 D890G probably damaging Het
Scarb1 C A 5: 125,281,100 probably null Het
Serpina10 A G 12: 103,626,897 probably benign Het
Slc12a5 T A 2: 164,986,663 W508R probably damaging Het
Slc43a2 T C 11: 75,562,850 C225R probably damaging Het
Slc6a9 T C 4: 117,864,859 F440L probably damaging Het
Stac3 G A 10: 127,508,148 R305H probably damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Syna A T 5: 134,559,543 L184H probably damaging Het
Tmprss7 T C 16: 45,673,939 N401S probably damaging Het
Yeats2 T A 16: 20,193,724 Y557* probably null Het
Zcchc11 T G 4: 108,527,004 S1089R probably damaging Het
Zfp352 T C 4: 90,224,285 S221P probably damaging Het
Zfp575 A G 7: 24,586,087 V43A probably benign Het
Zfp775 A G 6: 48,620,772 T527A probably benign Het
Other mutations in Cfap46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00493:Cfap46 APN 7 139614443 missense probably benign 0.06
IGL00505:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00508:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00514:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL01394:Cfap46 APN 7 139666979 missense probably damaging 1.00
IGL01621:Cfap46 APN 7 139606607 missense unknown
IGL02171:Cfap46 APN 7 139667056 missense possibly damaging 0.86
IGL02343:Cfap46 APN 7 139682509 missense probably damaging 0.99
IGL02679:Cfap46 APN 7 139614470 missense probably damaging 0.99
IGL02687:Cfap46 APN 7 139607201 missense probably damaging 0.99
IGL03180:Cfap46 APN 7 139603252 missense unknown
IGL03329:Cfap46 APN 7 139601165 missense probably damaging 0.99
FR4449:Cfap46 UTSW 7 139638795 utr 3 prime probably benign
FR4737:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
FR4976:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
PIT4651001:Cfap46 UTSW 7 139645551 missense
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0318:Cfap46 UTSW 7 139654566 missense probably damaging 1.00
R0358:Cfap46 UTSW 7 139651533 splice site probably benign
R0650:Cfap46 UTSW 7 139605655 missense unknown
R0675:Cfap46 UTSW 7 139676034 missense probably damaging 1.00
R0750:Cfap46 UTSW 7 139654670 missense probably damaging 1.00
R0931:Cfap46 UTSW 7 139655841 missense probably damaging 1.00
R1024:Cfap46 UTSW 7 139642597 missense probably benign 0.42
R1251:Cfap46 UTSW 7 139601265 missense probably benign 0.40
R1257:Cfap46 UTSW 7 139654629 nonsense probably null
R1538:Cfap46 UTSW 7 139683008 missense probably null 1.00
R1618:Cfap46 UTSW 7 139652810 missense probably benign 0.04
R1655:Cfap46 UTSW 7 139642520 nonsense probably null
R1824:Cfap46 UTSW 7 139639602 missense probably benign 0.12
R1830:Cfap46 UTSW 7 139640407 missense possibly damaging 0.92
R1857:Cfap46 UTSW 7 139653408 missense probably damaging 1.00
R1870:Cfap46 UTSW 7 139683470 missense probably damaging 1.00
R1945:Cfap46 UTSW 7 139679903 missense probably damaging 1.00
R1962:Cfap46 UTSW 7 139667041 missense probably damaging 1.00
R2108:Cfap46 UTSW 7 139683761 missense probably benign 0.03
R2354:Cfap46 UTSW 7 139661046 missense probably damaging 0.99
R2367:Cfap46 UTSW 7 139653498 missense probably damaging 0.99
R3237:Cfap46 UTSW 7 139617590 missense probably damaging 1.00
R3617:Cfap46 UTSW 7 139639599 missense probably benign 0.06
R3949:Cfap46 UTSW 7 139678551 missense probably benign 0.12
R4239:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4240:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4297:Cfap46 UTSW 7 139652673 missense probably benign 0.27
R4365:Cfap46 UTSW 7 139650952 missense probably damaging 0.99
R4516:Cfap46 UTSW 7 139660082 intron probably benign
R4595:Cfap46 UTSW 7 139652404 missense possibly damaging 0.74
R4627:Cfap46 UTSW 7 139657281 missense probably damaging 0.99
R4627:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4628:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4629:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4687:Cfap46 UTSW 7 139627456 missense possibly damaging 0.79
R4750:Cfap46 UTSW 7 139679323 critical splice donor site probably null
R4771:Cfap46 UTSW 7 139630608 missense probably null
R4779:Cfap46 UTSW 7 139659815 intron probably benign
R4812:Cfap46 UTSW 7 139636000 missense probably damaging 1.00
R4974:Cfap46 UTSW 7 139607188 critical splice donor site probably null
R5014:Cfap46 UTSW 7 139627375 missense probably benign 0.12
R5033:Cfap46 UTSW 7 139603860 missense probably benign 0.00
R5055:Cfap46 UTSW 7 139661190 missense probably damaging 1.00
R5254:Cfap46 UTSW 7 139678514 missense possibly damaging 0.77
R5288:Cfap46 UTSW 7 139613507 critical splice donor site probably null
R5366:Cfap46 UTSW 7 139650886 missense probably damaging 1.00
R5368:Cfap46 UTSW 7 139627473 missense possibly damaging 0.77
R5371:Cfap46 UTSW 7 139632181 splice site probably null
R5642:Cfap46 UTSW 7 139678577 missense probably damaging 1.00
R5690:Cfap46 UTSW 7 139638353 missense probably benign 0.01
R5691:Cfap46 UTSW 7 139606700 missense possibly damaging 0.49
R5696:Cfap46 UTSW 7 139612031 missense probably damaging 1.00
R5844:Cfap46 UTSW 7 139650942 missense probably damaging 0.99
R5963:Cfap46 UTSW 7 139651595 missense probably damaging 0.97
R6217:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6228:Cfap46 UTSW 7 139656580 missense probably damaging 1.00
R6251:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6253:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6285:Cfap46 UTSW 7 139661085 missense probably damaging 1.00
R6334:Cfap46 UTSW 7 139680831 missense probably damaging 1.00
R6520:Cfap46 UTSW 7 139614405 critical splice donor site probably null
R6736:Cfap46 UTSW 7 139619971 missense possibly damaging 0.92
R6760:Cfap46 UTSW 7 139652440 missense probably damaging 1.00
R6773:Cfap46 UTSW 7 139642561 utr 3 prime probably benign
R6835:Cfap46 UTSW 7 139652498 missense probably damaging 0.98
R6903:Cfap46 UTSW 7 139654561 critical splice donor site probably null
R6912:Cfap46 UTSW 7 139639700 missense probably benign 0.09
R7163:Cfap46 UTSW 7 139618078 critical splice donor site probably null
R7232:Cfap46 UTSW 7 139617577 missense unknown
R7336:Cfap46 UTSW 7 139620104 missense unknown
R7337:Cfap46 UTSW 7 139630576 critical splice donor site probably null
R7437:Cfap46 UTSW 7 139650837 nonsense probably null
R7450:Cfap46 UTSW 7 139617437 missense unknown
R7495:Cfap46 UTSW 7 139603196 critical splice donor site probably null
W0251:Cfap46 UTSW 7 139603946 missense probably benign 0.11
X0018:Cfap46 UTSW 7 139680912 missense probably benign 0.03
X0064:Cfap46 UTSW 7 139603447 missense probably benign 0.01
Z1088:Cfap46 UTSW 7 139635064 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACACAGGTGTAGATCAGCAGCAATG -3'
(R):5'- GTGTCCAGTAGGGACAGATGCAAC -3'

Sequencing Primer
(F):5'- CTGGCACACATTTGCAGTAG -3'
(R):5'- TCTGGGTCCTACAACAGCTAGAG -3'
Posted On2013-08-06