Incidental Mutation 'R0053:Tyw5'
ID64317
Institutional Source Beutler Lab
Gene Symbol Tyw5
Ensembl Gene ENSMUSG00000048495
Gene NametRNA-yW synthesizing protein 5
Synonyms1110034B05Rik
MMRRC Submission 038347-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R0053 (G1)
Quality Score156
Status Validated
Chromosome1
Chromosomal Location57388237-57407101 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 57401438 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 55 (T55M)
Ref Sequence ENSEMBL: ENSMUSP00000125386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027114] [ENSMUST00000079998] [ENSMUST00000160118] [ENSMUST00000160837] [ENSMUST00000162686]
Predicted Effect probably benign
Transcript: ENSMUST00000027114
SMART Domains Protein: ENSMUSP00000027114
Gene: ENSMUSG00000025971

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Blast:Tim44 131 210 3e-11 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000079998
AA Change: T55M

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000078912
Gene: ENSMUSG00000048495
AA Change: T55M

DomainStartEndE-ValueType
PDB:3AL6|D 1 71 3e-39 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097732
Predicted Effect probably damaging
Transcript: ENSMUST00000160118
AA Change: T55M

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125386
Gene: ENSMUSG00000048495
AA Change: T55M

DomainStartEndE-ValueType
PDB:3AL6|D 1 71 1e-38 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000160837
AA Change: T49M

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128576
Gene: ENSMUSG00000048495
AA Change: T49M

DomainStartEndE-ValueType
JmjC 103 255 2.25e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161780
SMART Domains Protein: ENSMUSP00000125487
Gene: ENSMUSG00000048495

DomainStartEndE-ValueType
PDB:3AL6|D 1 71 3e-39 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000162686
AA Change: T55M

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125427
Gene: ENSMUSG00000048495
AA Change: T55M

DomainStartEndE-ValueType
JmjC 105 265 5.8e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163039
Meta Mutation Damage Score 0.0232 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.5%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,327,590 D711E probably benign Het
5730559C18Rik C T 1: 136,227,550 V106I probably benign Het
Ada A T 2: 163,732,292 V148D probably damaging Het
Alpi T C 1: 87,098,790 D493G probably benign Het
Atp10b A G 11: 43,216,564 probably benign Het
AY761185 A T 8: 20,944,530 probably benign Het
BC067074 T C 13: 113,368,489 W2051R probably benign Het
Cadm1 C T 9: 47,799,414 T205I probably damaging Het
Capn3 A G 2: 120,491,837 I413V possibly damaging Het
Cblb C T 16: 52,142,801 T369I probably damaging Het
Ccdc54 T A 16: 50,590,234 N223I probably benign Het
Cdc25c A G 18: 34,735,435 V294A probably benign Het
Cep170 A T 1: 176,782,380 S122T possibly damaging Het
Chd1 A G 17: 15,747,189 N849D probably damaging Het
Dpp3 A G 19: 4,923,126 C147R probably damaging Het
Dst A G 1: 34,294,550 probably null Het
Fbxw9 T A 8: 85,064,454 L250Q probably damaging Het
Gpr75 A T 11: 30,892,571 Q492L possibly damaging Het
Gramd4 T A 15: 86,130,138 probably benign Het
Hivep2 T C 10: 14,132,121 C1488R probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Insr A G 8: 3,155,683 S1369P probably damaging Het
Insrr A C 3: 87,800,452 D67A probably damaging Het
Irf2 T A 8: 46,818,851 Y158N probably benign Het
Katnbl1 A G 2: 112,404,241 R23G probably benign Het
Lamb2 T A 9: 108,486,737 C987* probably null Het
Lzts2 T C 19: 45,026,307 probably benign Het
Mmp14 T A 14: 54,438,652 probably benign Het
Mycbpap A G 11: 94,511,736 Y258H probably damaging Het
Nav3 A G 10: 109,766,917 probably benign Het
Olfr1186 T A 2: 88,526,163 N193K probably damaging Het
Olfr1406 T C 1: 173,184,278 D52G probably benign Het
Parp10 T A 15: 76,242,246 L247F probably damaging Het
Pcsk6 C T 7: 65,983,703 probably benign Het
Pgap3 A T 11: 98,391,098 V129D probably damaging Het
Pibf1 A G 14: 99,140,557 Y373C probably damaging Het
Plcb1 A G 2: 135,294,915 E310G probably benign Het
Plin3 T C 17: 56,279,892 D385G probably damaging Het
Pole A T 5: 110,293,340 D220V probably damaging Het
Ptprk T A 10: 28,475,109 F533I probably damaging Het
Rufy1 A T 11: 50,401,465 M499K probably benign Het
Scn1a T G 2: 66,299,775 D1232A probably benign Het
Sec23ip T C 7: 128,745,167 L49P probably damaging Het
Sf3b1 G A 1: 55,000,373 Q698* probably null Het
Shprh A T 10: 11,194,372 probably null Het
Snd1 C A 6: 28,745,335 probably benign Het
Stab1 C T 14: 31,140,687 A2260T possibly damaging Het
Stpg2 A G 3: 139,212,321 Q60R probably benign Het
Strn T C 17: 78,656,934 H687R possibly damaging Het
Tgfb3 A T 12: 86,077,829 I35N probably damaging Het
Tnks2 T C 19: 36,875,365 S166P probably damaging Het
Usp19 A G 9: 108,497,170 probably null Het
Zfp13 A T 17: 23,576,148 I483N probably damaging Het
Other mutations in Tyw5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Tyw5 APN 1 57388553 nonsense probably null
IGL01565:Tyw5 APN 1 57394081 missense probably damaging 1.00
IGL01675:Tyw5 APN 1 57388632 missense possibly damaging 0.94
IGL01915:Tyw5 APN 1 57401469 missense probably damaging 0.99
IGL02320:Tyw5 APN 1 57396725 critical splice donor site probably null
IGL02427:Tyw5 APN 1 57388725 missense possibly damaging 0.68
PIT4520001:Tyw5 UTSW 1 57388515 missense probably damaging 1.00
R0053:Tyw5 UTSW 1 57401438 missense probably damaging 0.97
R2421:Tyw5 UTSW 1 57396748 missense possibly damaging 0.58
R2422:Tyw5 UTSW 1 57396748 missense possibly damaging 0.58
R2997:Tyw5 UTSW 1 57388641 missense probably damaging 1.00
R3974:Tyw5 UTSW 1 57391528 missense probably damaging 1.00
R4235:Tyw5 UTSW 1 57388488 utr 3 prime probably benign
R4630:Tyw5 UTSW 1 57388527 missense probably damaging 0.96
R5014:Tyw5 UTSW 1 57406845 start gained probably benign
R5099:Tyw5 UTSW 1 57388705 missense probably damaging 0.99
R5162:Tyw5 UTSW 1 57401459 missense probably damaging 1.00
R6389:Tyw5 UTSW 1 57391499 missense probably damaging 1.00
R6422:Tyw5 UTSW 1 57401411 missense probably damaging 0.99
R6524:Tyw5 UTSW 1 57388731 missense possibly damaging 0.67
R6908:Tyw5 UTSW 1 57401523 missense probably damaging 1.00
X0018:Tyw5 UTSW 1 57390663 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTCCATGACTCCACAGAACACAGG -3'
(R):5'- CTTAGGCTGAGATGAAAGCCACACTC -3'

Sequencing Primer
(F):5'- GCCACTCATTAAAAAGGAGTAAGC -3'
(R):5'- CACTCTGATACCAAGGAAGTTGTTG -3'
Posted On2013-08-06