Incidental Mutation 'R0053:Ada'
ID64322
Institutional Source Beutler Lab
Gene Symbol Ada
Ensembl Gene ENSMUSG00000017697
Gene Nameadenosine deaminase
Synonyms
MMRRC Submission 038347-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0053 (G1)
Quality Score118
Status Validated
Chromosome2
Chromosomal Location163726584-163750239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 163732292 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 148 (V148D)
Ref Sequence ENSEMBL: ENSMUSP00000017841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017841]
PDB Structure
ADA STRUCTURE COMPLEXED WITH DEOXYCOFORMYCIN AT PH 7.0 [X-RAY DIFFRACTION]
ADA STRUCTURE COMPLEXED WITH PURINE RIBOSIDE AT PH 7.0 [X-RAY DIFFRACTION]
A PRE-TRANSITION STATE MIMIC OF AN ENZYME: X-RAY STRUCTURE OF ADENOSINE DEAMINASE WITH BOUND 1-DEAZA-ADENOSINE AND ZINC-ACTIVATED WATER [X-RAY DIFFRACTION]
MURINE ADENOSINE DEAMINASE (D295E) [X-RAY DIFFRACTION]
MURINE ADENOSINE DEAMINASE (D296A) [X-RAY DIFFRACTION]
ADENOSINE DEAMINASE (HIS 238 ALA MUTANT) [X-RAY DIFFRACTION]
ADENOSINE DEAMINASE (HIS 238 GLU MUTANT) [X-RAY DIFFRACTION]
ATOMIC STRUCTURE OF ADENOSINE DEAMINASE COMPLEXED WITH A TRANSITION-STATE ANALOG: UNDERSTANDING CATALYSIS AND IMMUNODEFICIENCY MUTATIONS [X-RAY DIFFRACTION]
Crystal structuore of adenosine deaminase from mus musculus complexed with 9-deazainosine [X-RAY DIFFRACTION]
Crystal structure of holo mADA at 1.6 A resolution [X-RAY DIFFRACTION]
>> 2 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000017841
AA Change: V148D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000017841
Gene: ENSMUSG00000017697
AA Change: V148D

DomainStartEndE-ValueType
Pfam:A_deaminase 8 346 1.3e-111 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156939
Meta Mutation Damage Score 0.032 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.5%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the hydrolysis of adenosine to inosine. Various mutations have been described for this gene and have been linked to human diseases. Deficiency in this enzyme causes a form of severe combined immunodeficiency disease (SCID), in which there is dysfunction of both B and T lymphocytes with impaired cellular immunity and decreased production of immunoglobulins, whereas elevated levels of this enzyme have been associated with congenital hemolytic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene die perinatally with defective purine metabolism and severe liver cell degeneration, but lack thymic abnormalities. Replacement of placental ADA can rescue ADA-deficient fetuses, resulting in mice that are T and B-cell deficient, have elevated dATP levels, and immune deficiencies resembling human ADA deficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,327,590 D711E probably benign Het
5730559C18Rik C T 1: 136,227,550 V106I probably benign Het
Alpi T C 1: 87,098,790 D493G probably benign Het
Atp10b A G 11: 43,216,564 probably benign Het
AY761185 A T 8: 20,944,530 probably benign Het
BC067074 T C 13: 113,368,489 W2051R probably benign Het
Cadm1 C T 9: 47,799,414 T205I probably damaging Het
Capn3 A G 2: 120,491,837 I413V possibly damaging Het
Cblb C T 16: 52,142,801 T369I probably damaging Het
Ccdc54 T A 16: 50,590,234 N223I probably benign Het
Cdc25c A G 18: 34,735,435 V294A probably benign Het
Cep170 A T 1: 176,782,380 S122T possibly damaging Het
Chd1 A G 17: 15,747,189 N849D probably damaging Het
Dpp3 A G 19: 4,923,126 C147R probably damaging Het
Dst A G 1: 34,294,550 probably null Het
Fbxw9 T A 8: 85,064,454 L250Q probably damaging Het
Gpr75 A T 11: 30,892,571 Q492L possibly damaging Het
Gramd4 T A 15: 86,130,138 probably benign Het
Hivep2 T C 10: 14,132,121 C1488R probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Insr A G 8: 3,155,683 S1369P probably damaging Het
Insrr A C 3: 87,800,452 D67A probably damaging Het
Irf2 T A 8: 46,818,851 Y158N probably benign Het
Katnbl1 A G 2: 112,404,241 R23G probably benign Het
Lamb2 T A 9: 108,486,737 C987* probably null Het
Lzts2 T C 19: 45,026,307 probably benign Het
Mmp14 T A 14: 54,438,652 probably benign Het
Mycbpap A G 11: 94,511,736 Y258H probably damaging Het
Nav3 A G 10: 109,766,917 probably benign Het
Olfr1186 T A 2: 88,526,163 N193K probably damaging Het
Olfr1406 T C 1: 173,184,278 D52G probably benign Het
Parp10 T A 15: 76,242,246 L247F probably damaging Het
Pcsk6 C T 7: 65,983,703 probably benign Het
Pgap3 A T 11: 98,391,098 V129D probably damaging Het
Pibf1 A G 14: 99,140,557 Y373C probably damaging Het
Plcb1 A G 2: 135,294,915 E310G probably benign Het
Plin3 T C 17: 56,279,892 D385G probably damaging Het
Pole A T 5: 110,293,340 D220V probably damaging Het
Ptprk T A 10: 28,475,109 F533I probably damaging Het
Rufy1 A T 11: 50,401,465 M499K probably benign Het
Scn1a T G 2: 66,299,775 D1232A probably benign Het
Sec23ip T C 7: 128,745,167 L49P probably damaging Het
Sf3b1 G A 1: 55,000,373 Q698* probably null Het
Shprh A T 10: 11,194,372 probably null Het
Snd1 C A 6: 28,745,335 probably benign Het
Stab1 C T 14: 31,140,687 A2260T possibly damaging Het
Stpg2 A G 3: 139,212,321 Q60R probably benign Het
Strn T C 17: 78,656,934 H687R possibly damaging Het
Tgfb3 A T 12: 86,077,829 I35N probably damaging Het
Tnks2 T C 19: 36,875,365 S166P probably damaging Het
Tyw5 G A 1: 57,401,438 T55M probably damaging Het
Usp19 A G 9: 108,497,170 probably null Het
Zfp13 A T 17: 23,576,148 I483N probably damaging Het
Other mutations in Ada
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01686:Ada APN 2 163730316 missense probably benign 0.02
IGL02414:Ada APN 2 163730040 missense probably benign
IGL02973:Ada APN 2 163731133 missense probably benign 0.01
R0076:Ada UTSW 2 163727603 unclassified probably benign
R0305:Ada UTSW 2 163728157 missense probably benign 0.00
R0463:Ada UTSW 2 163730351 missense probably benign 0.00
R0464:Ada UTSW 2 163732964 nonsense probably null
R0701:Ada UTSW 2 163730075 missense probably benign 0.30
R1474:Ada UTSW 2 163732894 missense possibly damaging 0.94
R4044:Ada UTSW 2 163735460 missense probably damaging 0.96
R4589:Ada UTSW 2 163732948 missense possibly damaging 0.94
R5114:Ada UTSW 2 163730486 missense probably benign 0.15
R5424:Ada UTSW 2 163728125 nonsense probably null
R5753:Ada UTSW 2 163735398 missense probably benign 0.00
R6392:Ada UTSW 2 163728217 missense probably damaging 1.00
R6501:Ada UTSW 2 163728188 unclassified probably null
R6646:Ada UTSW 2 163735423 missense probably benign
Z1088:Ada UTSW 2 163728116 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGCTGTCAAGTCCCAGATTTCCTG -3'
(R):5'- TTGAGGCTGTGTCTCTCCCCTAAG -3'

Sequencing Primer
(F):5'- GTCCCAGATTTCCTGTTAAGGAGAC -3'
(R):5'- TCAATGAATGAGTCTGGCCC -3'
Posted On2013-08-06