Incidental Mutation 'R0053:Cadm1'
ID64329
Institutional Source Beutler Lab
Gene Symbol Cadm1
Ensembl Gene ENSMUSG00000032076
Gene Namecell adhesion molecule 1
SynonymsSynCam, RA175A, Igsf4a, RA175B, RA175C, RA175N, Igsf4, 2900073G06Rik, 3100001I08Rik, SgIGSF, Tslc1, Necl2
MMRRC Submission 038347-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0053 (G1)
Quality Score163
Status Validated
Chromosome9
Chromosomal Location47530173-47857637 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 47799414 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 205 (T205I)
Ref Sequence ENSEMBL: ENSMUSP00000124555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034581] [ENSMUST00000085909] [ENSMUST00000114547] [ENSMUST00000114548] [ENSMUST00000143026] [ENSMUST00000152459]
Predicted Effect probably damaging
Transcript: ENSMUST00000034581
AA Change: T205I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034581
Gene: ENSMUSG00000032076
AA Change: T205I

DomainStartEndE-ValueType
low complexity region 13 41 N/A INTRINSIC
IG 52 144 3.33e-9 SMART
IG_like 160 230 8.08e-1 SMART
IGc2 261 323 2.08e-10 SMART
low complexity region 345 360 N/A INTRINSIC
4.1m 370 388 1.5e-3 SMART
low complexity region 389 396 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085909
AA Change: T205I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083073
Gene: ENSMUSG00000032076
AA Change: T205I

DomainStartEndE-ValueType
low complexity region 13 41 N/A INTRINSIC
IG 52 144 3.33e-9 SMART
IG_like 160 230 8.08e-1 SMART
IGc2 261 323 2.08e-10 SMART
low complexity region 336 368 N/A INTRINSIC
low complexity region 384 399 N/A INTRINSIC
4.1m 409 427 1.5e-3 SMART
low complexity region 428 435 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114547
AA Change: T205I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110194
Gene: ENSMUSG00000032076
AA Change: T205I

DomainStartEndE-ValueType
low complexity region 13 41 N/A INTRINSIC
IG 52 144 3.33e-9 SMART
IG_like 160 230 8.08e-1 SMART
IGc2 261 323 2.08e-10 SMART
low complexity region 336 362 N/A INTRINSIC
low complexity region 373 388 N/A INTRINSIC
4.1m 398 416 1.5e-3 SMART
low complexity region 417 424 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114548
AA Change: T205I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110195
Gene: ENSMUSG00000032076
AA Change: T205I

DomainStartEndE-ValueType
low complexity region 13 41 N/A INTRINSIC
IG 52 144 3.33e-9 SMART
IG_like 160 230 8.08e-1 SMART
IGc2 261 323 2.08e-10 SMART
low complexity region 356 371 N/A INTRINSIC
4.1m 381 399 1.5e-3 SMART
low complexity region 400 407 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124073
Predicted Effect probably damaging
Transcript: ENSMUST00000143026
AA Change: T205I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124555
Gene: ENSMUSG00000032076
AA Change: T205I

DomainStartEndE-ValueType
low complexity region 13 41 N/A INTRINSIC
IG 52 144 3.33e-9 SMART
IG_like 160 230 8.08e-1 SMART
IGc2 261 323 2.08e-10 SMART
transmembrane domain 349 371 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151624
Predicted Effect probably damaging
Transcript: ENSMUST00000152459
AA Change: T205I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124119
Gene: ENSMUSG00000032076
AA Change: T205I

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
IG 52 144 3.33e-9 SMART
IG_like 160 230 8.08e-1 SMART
IGc2 261 323 2.08e-10 SMART
low complexity region 336 368 N/A INTRINSIC
low complexity region 402 417 N/A INTRINSIC
4.1m 427 445 1.5e-3 SMART
low complexity region 446 453 N/A INTRINSIC
Meta Mutation Damage Score 0.166 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.5%
Validation Efficiency 100% (67/67)
MGI Phenotype PHENOTYPE: Homozygous mutant male show infertility due to block in maturation of spermatogenesis. Mice homozygous for a gene trap allele exhibit decreased body size, impaired T cell development, and impaired T cell response to anti-CD3/CD28 antibody stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,327,590 D711E probably benign Het
5730559C18Rik C T 1: 136,227,550 V106I probably benign Het
Ada A T 2: 163,732,292 V148D probably damaging Het
Alpi T C 1: 87,098,790 D493G probably benign Het
Atp10b A G 11: 43,216,564 probably benign Het
AY761185 A T 8: 20,944,530 probably benign Het
BC067074 T C 13: 113,368,489 W2051R probably benign Het
Capn3 A G 2: 120,491,837 I413V possibly damaging Het
Cblb C T 16: 52,142,801 T369I probably damaging Het
Ccdc54 T A 16: 50,590,234 N223I probably benign Het
Cdc25c A G 18: 34,735,435 V294A probably benign Het
Cep170 A T 1: 176,782,380 S122T possibly damaging Het
Chd1 A G 17: 15,747,189 N849D probably damaging Het
Dpp3 A G 19: 4,923,126 C147R probably damaging Het
Dst A G 1: 34,294,550 probably null Het
Fbxw9 T A 8: 85,064,454 L250Q probably damaging Het
Gpr75 A T 11: 30,892,571 Q492L possibly damaging Het
Gramd4 T A 15: 86,130,138 probably benign Het
Hivep2 T C 10: 14,132,121 C1488R probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Insr A G 8: 3,155,683 S1369P probably damaging Het
Insrr A C 3: 87,800,452 D67A probably damaging Het
Irf2 T A 8: 46,818,851 Y158N probably benign Het
Katnbl1 A G 2: 112,404,241 R23G probably benign Het
Lamb2 T A 9: 108,486,737 C987* probably null Het
Lzts2 T C 19: 45,026,307 probably benign Het
Mmp14 T A 14: 54,438,652 probably benign Het
Mycbpap A G 11: 94,511,736 Y258H probably damaging Het
Nav3 A G 10: 109,766,917 probably benign Het
Olfr1186 T A 2: 88,526,163 N193K probably damaging Het
Olfr1406 T C 1: 173,184,278 D52G probably benign Het
Parp10 T A 15: 76,242,246 L247F probably damaging Het
Pcsk6 C T 7: 65,983,703 probably benign Het
Pgap3 A T 11: 98,391,098 V129D probably damaging Het
Pibf1 A G 14: 99,140,557 Y373C probably damaging Het
Plcb1 A G 2: 135,294,915 E310G probably benign Het
Plin3 T C 17: 56,279,892 D385G probably damaging Het
Pole A T 5: 110,293,340 D220V probably damaging Het
Ptprk T A 10: 28,475,109 F533I probably damaging Het
Rufy1 A T 11: 50,401,465 M499K probably benign Het
Scn1a T G 2: 66,299,775 D1232A probably benign Het
Sec23ip T C 7: 128,745,167 L49P probably damaging Het
Sf3b1 G A 1: 55,000,373 Q698* probably null Het
Shprh A T 10: 11,194,372 probably null Het
Snd1 C A 6: 28,745,335 probably benign Het
Stab1 C T 14: 31,140,687 A2260T possibly damaging Het
Stpg2 A G 3: 139,212,321 Q60R probably benign Het
Strn T C 17: 78,656,934 H687R possibly damaging Het
Tgfb3 A T 12: 86,077,829 I35N probably damaging Het
Tnks2 T C 19: 36,875,365 S166P probably damaging Het
Tyw5 G A 1: 57,401,438 T55M probably damaging Het
Usp19 A G 9: 108,497,170 probably null Het
Zfp13 A T 17: 23,576,148 I483N probably damaging Het
Other mutations in Cadm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01697:Cadm1 APN 9 47850324 missense probably damaging 1.00
IGL01899:Cadm1 APN 9 47810091 missense probably damaging 0.97
IGL02154:Cadm1 APN 9 47813903 missense probably benign 0.00
IGL03196:Cadm1 APN 9 47799377 missense possibly damaging 0.81
R0053:Cadm1 UTSW 9 47799414 missense probably damaging 1.00
R0058:Cadm1 UTSW 9 47850331 missense probably damaging 1.00
R0058:Cadm1 UTSW 9 47850331 missense probably damaging 1.00
R0671:Cadm1 UTSW 9 47813806 missense probably benign 0.30
R0717:Cadm1 UTSW 9 47810068 missense probably benign 0.14
R1622:Cadm1 UTSW 9 47813841 missense probably benign 0.35
R1817:Cadm1 UTSW 9 47829370 splice site probably benign
R1958:Cadm1 UTSW 9 47850335 missense probably damaging 1.00
R3124:Cadm1 UTSW 9 47799477 missense possibly damaging 0.94
R4214:Cadm1 UTSW 9 47797443 missense probably damaging 0.99
R4449:Cadm1 UTSW 9 47813988 intron probably benign
R4449:Cadm1 UTSW 9 47530437 missense possibly damaging 0.85
R4701:Cadm1 UTSW 9 47818822 splice site probably benign
R5932:Cadm1 UTSW 9 47799451 missense probably damaging 1.00
R6013:Cadm1 UTSW 9 47857274 unclassified probably benign
R6315:Cadm1 UTSW 9 47810119 missense probably damaging 0.98
R6481:Cadm1 UTSW 9 47788109 missense probably damaging 1.00
R7121:Cadm1 UTSW 9 47799410 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGGCAGCCAAGTGTCAAAATG -3'
(R):5'- ACAGATTGCATACGGACTTCAAGGG -3'

Sequencing Primer
(F):5'- TATCTGGACCACTGTTACACAAGG -3'
(R):5'- CGGACTTCAAGGGAAGGAGC -3'
Posted On2013-08-06