Incidental Mutation 'R0053:Gpr75'
ID64336
Institutional Source Beutler Lab
Gene Symbol Gpr75
Ensembl Gene ENSMUSG00000043999
Gene NameG protein-coupled receptor 75
Synonyms
MMRRC Submission 038347-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R0053 (G1)
Quality Score144
Status Validated
Chromosome11
Chromosomal Location30885358-30893729 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30892571 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 492 (Q492L)
Ref Sequence ENSEMBL: ENSMUSP00000105057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109430] [ENSMUST00000203878]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109430
AA Change: Q492L

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105057
Gene: ENSMUSG00000043999
AA Change: Q492L

DomainStartEndE-ValueType
Pfam:7tm_1 59 376 1.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203878
SMART Domains Protein: ENSMUSP00000144900
Gene: ENSMUSG00000020305

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
ANK 48 77 3.5e-2 SMART
ANK 81 110 8e-3 SMART
ANK 117 146 4.8e-5 SMART
ANK 150 179 1.7e-7 SMART
ANK 184 213 1.8e-4 SMART
ANK 217 246 1.8e-6 SMART
ANK 250 279 1.2e-7 SMART
ANK 285 315 1.1e0 SMART
ANK 318 347 1.2e-3 SMART
ANK 354 385 7.7e-1 SMART
SOCS 493 542 2.8e-4 SMART
SOCS_box 499 541 1.6e-17 SMART
Meta Mutation Damage Score 0.034 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.5%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GPR75 is a member of the G protein-coupled receptor family. GPRs are cell surface receptors that activate guanine-nucleotide binding proteins upon the binding of a ligand.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,327,590 D711E probably benign Het
5730559C18Rik C T 1: 136,227,550 V106I probably benign Het
Ada A T 2: 163,732,292 V148D probably damaging Het
Alpi T C 1: 87,098,790 D493G probably benign Het
Atp10b A G 11: 43,216,564 probably benign Het
AY761185 A T 8: 20,944,530 probably benign Het
BC067074 T C 13: 113,368,489 W2051R probably benign Het
Cadm1 C T 9: 47,799,414 T205I probably damaging Het
Capn3 A G 2: 120,491,837 I413V possibly damaging Het
Cblb C T 16: 52,142,801 T369I probably damaging Het
Ccdc54 T A 16: 50,590,234 N223I probably benign Het
Cdc25c A G 18: 34,735,435 V294A probably benign Het
Cep170 A T 1: 176,782,380 S122T possibly damaging Het
Chd1 A G 17: 15,747,189 N849D probably damaging Het
Dpp3 A G 19: 4,923,126 C147R probably damaging Het
Dst A G 1: 34,294,550 probably null Het
Fbxw9 T A 8: 85,064,454 L250Q probably damaging Het
Gramd4 T A 15: 86,130,138 probably benign Het
Hivep2 T C 10: 14,132,121 C1488R probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Insr A G 8: 3,155,683 S1369P probably damaging Het
Insrr A C 3: 87,800,452 D67A probably damaging Het
Irf2 T A 8: 46,818,851 Y158N probably benign Het
Katnbl1 A G 2: 112,404,241 R23G probably benign Het
Lamb2 T A 9: 108,486,737 C987* probably null Het
Lzts2 T C 19: 45,026,307 probably benign Het
Mmp14 T A 14: 54,438,652 probably benign Het
Mycbpap A G 11: 94,511,736 Y258H probably damaging Het
Nav3 A G 10: 109,766,917 probably benign Het
Olfr1186 T A 2: 88,526,163 N193K probably damaging Het
Olfr1406 T C 1: 173,184,278 D52G probably benign Het
Parp10 T A 15: 76,242,246 L247F probably damaging Het
Pcsk6 C T 7: 65,983,703 probably benign Het
Pgap3 A T 11: 98,391,098 V129D probably damaging Het
Pibf1 A G 14: 99,140,557 Y373C probably damaging Het
Plcb1 A G 2: 135,294,915 E310G probably benign Het
Plin3 T C 17: 56,279,892 D385G probably damaging Het
Pole A T 5: 110,293,340 D220V probably damaging Het
Ptprk T A 10: 28,475,109 F533I probably damaging Het
Rufy1 A T 11: 50,401,465 M499K probably benign Het
Scn1a T G 2: 66,299,775 D1232A probably benign Het
Sec23ip T C 7: 128,745,167 L49P probably damaging Het
Sf3b1 G A 1: 55,000,373 Q698* probably null Het
Shprh A T 10: 11,194,372 probably null Het
Snd1 C A 6: 28,745,335 probably benign Het
Stab1 C T 14: 31,140,687 A2260T possibly damaging Het
Stpg2 A G 3: 139,212,321 Q60R probably benign Het
Strn T C 17: 78,656,934 H687R possibly damaging Het
Tgfb3 A T 12: 86,077,829 I35N probably damaging Het
Tnks2 T C 19: 36,875,365 S166P probably damaging Het
Tyw5 G A 1: 57,401,438 T55M probably damaging Het
Usp19 A G 9: 108,497,170 probably null Het
Zfp13 A T 17: 23,576,148 I483N probably damaging Het
Other mutations in Gpr75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Gpr75 APN 11 30891590 missense probably damaging 1.00
IGL00787:Gpr75 APN 11 30892290 missense probably benign 0.00
IGL01102:Gpr75 APN 11 30891755 missense probably benign 0.41
IGL01790:Gpr75 APN 11 30891132 missense probably damaging 0.97
IGL01975:Gpr75 APN 11 30891835 missense probably benign 0.09
IGL02266:Gpr75 APN 11 30891977 missense probably benign 0.01
IGL02338:Gpr75 APN 11 30891730 missense probably benign 0.00
IGL02394:Gpr75 APN 11 30892190 missense possibly damaging 0.92
IGL03208:Gpr75 APN 11 30892699 missense probably damaging 1.00
R0053:Gpr75 UTSW 11 30892571 missense possibly damaging 0.71
R0449:Gpr75 UTSW 11 30892456 missense probably damaging 0.99
R1289:Gpr75 UTSW 11 30892706 missense probably benign 0.23
R1760:Gpr75 UTSW 11 30891527 missense probably damaging 1.00
R3123:Gpr75 UTSW 11 30891709 missense possibly damaging 0.82
R4669:Gpr75 UTSW 11 30892072 missense probably damaging 1.00
R4704:Gpr75 UTSW 11 30891110 missense probably benign
R4809:Gpr75 UTSW 11 30892154 missense possibly damaging 0.74
R4913:Gpr75 UTSW 11 30891808 missense possibly damaging 0.85
R4982:Gpr75 UTSW 11 30891462 missense probably damaging 1.00
R4982:Gpr75 UTSW 11 30891463 missense possibly damaging 0.96
R5071:Gpr75 UTSW 11 30892380 missense probably damaging 1.00
R5318:Gpr75 UTSW 11 30892459 missense probably benign 0.00
R6019:Gpr75 UTSW 11 30891640 missense probably benign 0.39
R6199:Gpr75 UTSW 11 30891527 missense probably damaging 1.00
R6455:Gpr75 UTSW 11 30891529 missense probably damaging 1.00
R7188:Gpr75 UTSW 11 30892687 missense probably damaging 1.00
Z1088:Gpr75 UTSW 11 30891139 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CTCTGCTGCAAACAGAAAACTCGAC -3'
(R):5'- AACCATTCCCTCCAGACTCGCT -3'

Sequencing Primer
(F):5'- AGAAAACTCGACTTCGGGC -3'
(R):5'- ATAGTGCATGGCGATGTAGG -3'
Posted On2013-08-06