Incidental Mutation 'R0053:Zfp13'
ID64346
Institutional Source Beutler Lab
Gene Symbol Zfp13
Ensembl Gene ENSMUSG00000062012
Gene Namezinc finger protein 13
SynonymsZfp-13, Krox-8
MMRRC Submission 038347-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R0053 (G1)
Quality Score147
Status Validated
Chromosome17
Chromosomal Location23575844-23599487 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23576148 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 483 (I483N)
Ref Sequence ENSEMBL: ENSMUSP00000111178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057029] [ENSMUST00000115516] [ENSMUST00000227952]
Predicted Effect probably damaging
Transcript: ENSMUST00000057029
AA Change: I476N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054595
Gene: ENSMUSG00000062012
AA Change: I476N

DomainStartEndE-ValueType
KRAB 117 179 7.54e-10 SMART
ZnF_C2H2 259 281 7.37e-4 SMART
ZnF_C2H2 287 309 1.2e-3 SMART
ZnF_C2H2 315 337 5.9e-3 SMART
ZnF_C2H2 343 365 1.26e-2 SMART
ZnF_C2H2 371 393 9.73e-4 SMART
ZnF_C2H2 399 421 2.12e-4 SMART
ZnF_C2H2 427 449 1.18e-2 SMART
ZnF_C2H2 455 477 6.52e-5 SMART
low complexity region 480 503 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115516
AA Change: I483N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111178
Gene: ENSMUSG00000062012
AA Change: I483N

DomainStartEndE-ValueType
KRAB 124 186 7.54e-10 SMART
ZnF_C2H2 266 288 7.37e-4 SMART
ZnF_C2H2 294 316 1.2e-3 SMART
ZnF_C2H2 322 344 5.9e-3 SMART
ZnF_C2H2 350 372 1.26e-2 SMART
ZnF_C2H2 378 400 9.73e-4 SMART
ZnF_C2H2 406 428 2.12e-4 SMART
ZnF_C2H2 434 456 1.18e-2 SMART
ZnF_C2H2 462 484 6.52e-5 SMART
low complexity region 487 510 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226550
Predicted Effect probably benign
Transcript: ENSMUST00000227952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228942
Meta Mutation Damage Score 0.136 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.5%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,327,590 D711E probably benign Het
5730559C18Rik C T 1: 136,227,550 V106I probably benign Het
Ada A T 2: 163,732,292 V148D probably damaging Het
Alpi T C 1: 87,098,790 D493G probably benign Het
Atp10b A G 11: 43,216,564 probably benign Het
AY761185 A T 8: 20,944,530 probably benign Het
BC067074 T C 13: 113,368,489 W2051R probably benign Het
Cadm1 C T 9: 47,799,414 T205I probably damaging Het
Capn3 A G 2: 120,491,837 I413V possibly damaging Het
Cblb C T 16: 52,142,801 T369I probably damaging Het
Ccdc54 T A 16: 50,590,234 N223I probably benign Het
Cdc25c A G 18: 34,735,435 V294A probably benign Het
Cep170 A T 1: 176,782,380 S122T possibly damaging Het
Chd1 A G 17: 15,747,189 N849D probably damaging Het
Dpp3 A G 19: 4,923,126 C147R probably damaging Het
Dst A G 1: 34,294,550 probably null Het
Fbxw9 T A 8: 85,064,454 L250Q probably damaging Het
Gpr75 A T 11: 30,892,571 Q492L possibly damaging Het
Gramd4 T A 15: 86,130,138 probably benign Het
Hivep2 T C 10: 14,132,121 C1488R probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Insr A G 8: 3,155,683 S1369P probably damaging Het
Insrr A C 3: 87,800,452 D67A probably damaging Het
Irf2 T A 8: 46,818,851 Y158N probably benign Het
Katnbl1 A G 2: 112,404,241 R23G probably benign Het
Lamb2 T A 9: 108,486,737 C987* probably null Het
Lzts2 T C 19: 45,026,307 probably benign Het
Mmp14 T A 14: 54,438,652 probably benign Het
Mycbpap A G 11: 94,511,736 Y258H probably damaging Het
Nav3 A G 10: 109,766,917 probably benign Het
Olfr1186 T A 2: 88,526,163 N193K probably damaging Het
Olfr1406 T C 1: 173,184,278 D52G probably benign Het
Parp10 T A 15: 76,242,246 L247F probably damaging Het
Pcsk6 C T 7: 65,983,703 probably benign Het
Pgap3 A T 11: 98,391,098 V129D probably damaging Het
Pibf1 A G 14: 99,140,557 Y373C probably damaging Het
Plcb1 A G 2: 135,294,915 E310G probably benign Het
Plin3 T C 17: 56,279,892 D385G probably damaging Het
Pole A T 5: 110,293,340 D220V probably damaging Het
Ptprk T A 10: 28,475,109 F533I probably damaging Het
Rufy1 A T 11: 50,401,465 M499K probably benign Het
Scn1a T G 2: 66,299,775 D1232A probably benign Het
Sec23ip T C 7: 128,745,167 L49P probably damaging Het
Sf3b1 G A 1: 55,000,373 Q698* probably null Het
Shprh A T 10: 11,194,372 probably null Het
Snd1 C A 6: 28,745,335 probably benign Het
Stab1 C T 14: 31,140,687 A2260T possibly damaging Het
Stpg2 A G 3: 139,212,321 Q60R probably benign Het
Strn T C 17: 78,656,934 H687R possibly damaging Het
Tgfb3 A T 12: 86,077,829 I35N probably damaging Het
Tnks2 T C 19: 36,875,365 S166P probably damaging Het
Tyw5 G A 1: 57,401,438 T55M probably damaging Het
Usp19 A G 9: 108,497,170 probably null Het
Other mutations in Zfp13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02236:Zfp13 APN 17 23580765 splice site probably benign
IGL02447:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL02449:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL02450:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL02466:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL02468:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL02471:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL02473:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL02474:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL02475:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL02491:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL02511:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL02558:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL03030:Zfp13 APN 17 23580845 missense probably benign 0.01
IGL03388:Zfp13 APN 17 23576914 missense probably benign 0.00
R0053:Zfp13 UTSW 17 23576148 missense probably damaging 1.00
R1514:Zfp13 UTSW 17 23576412 missense probably damaging 1.00
R2420:Zfp13 UTSW 17 23576212 missense probably damaging 1.00
R3433:Zfp13 UTSW 17 23576628 missense probably damaging 0.99
R4458:Zfp13 UTSW 17 23581176 missense probably benign 0.01
R4650:Zfp13 UTSW 17 23580138 missense probably damaging 1.00
R4824:Zfp13 UTSW 17 23576823 missense possibly damaging 0.95
R5088:Zfp13 UTSW 17 23577061 nonsense probably null
R5110:Zfp13 UTSW 17 23580860 missense probably benign 0.02
R5384:Zfp13 UTSW 17 23581182 missense probably damaging 1.00
R7302:Zfp13 UTSW 17 23581062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAAGGGCACAGCTTGAAATC -3'
(R):5'- TTGGAAGAGCTTCAGCCACCAC -3'

Sequencing Primer
(F):5'- ACTGGCTAAGACCCAGCG -3'
(R):5'- ACTGGTGAGAAGCCCTACG -3'
Posted On2013-08-06