Incidental Mutation 'R0060:Slc30a4'
ID64387
Institutional Source Beutler Lab
Gene Symbol Slc30a4
Ensembl Gene ENSMUSG00000005802
Gene Namesolute carrier family 30 (zinc transporter), member 4
SynonymsZnt4
MMRRC Submission 038353-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.286) question?
Stock #R0060 (G1)
Quality Score114
Status Not validated
Chromosome2
Chromosomal Location122681233-122702663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 122685184 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 381 (T381S)
Ref Sequence ENSEMBL: ENSMUSP00000097056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005952] [ENSMUST00000099457]
Predicted Effect probably benign
Transcript: ENSMUST00000005952
AA Change: T430S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000005952
Gene: ENSMUSG00000005802
AA Change: T430S

DomainStartEndE-ValueType
low complexity region 67 83 N/A INTRINSIC
Pfam:Cation_efflux 114 333 1.3e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099457
AA Change: T381S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097056
Gene: ENSMUSG00000005802
AA Change: T381S

DomainStartEndE-ValueType
low complexity region 67 83 N/A INTRINSIC
Pfam:Cation_efflux 124 368 4.6e-46 PFAM
Meta Mutation Damage Score 0.1284 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is the second most abundant trace metal in the human body. It is an essential element, serving both a structural role, as in the formation of zinc fingers in DNA-binding proteins, and a catalytic role in metalloenzymes, such as pancreatic carboxypeptidases (e.g., MIM 114852), alkaline phosphatases (e.g., MIM 171760), various dehydrogenases, and superoxide dismutases (e.g., MIM 147450). SLC30A4, or ZNT4, belongs to the ZNT family of zinc transporters. ZNTs are involved in transporting zinc out of the cytoplasm and have similar structures, consisting of 6 transmembrane domains and a histidine-rich cytoplasmic loop (Huang and Gitschier, 1997 [PubMed 9354792]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant dams produce zinc-deficient milk that is lethal to all nursing pups. Pleiotropic defects observed in mutant males and females include otolith degeneration, impaired motor coordination, alopecia, and dermatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A C 11: 58,422,182 probably benign Het
A630091E08Rik A G 7: 98,543,668 noncoding transcript Het
Abca8a T C 11: 110,070,480 T539A probably damaging Het
Ankrd60 A T 2: 173,572,613 M1K probably null Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Cabcoco1 A T 10: 68,533,862 probably null Het
Capn7 T C 14: 31,365,604 probably benign Het
Cd109 G A 9: 78,703,107 E1145K probably damaging Het
Celsr1 A T 15: 85,922,198 V2353D probably damaging Het
Cep350 C T 1: 155,928,626 D904N probably damaging Het
Chl1 T A 6: 103,711,058 probably benign Het
Colec10 G A 15: 54,439,146 probably benign Het
Cst11 T A 2: 148,770,402 Q105L probably damaging Het
Eps8l3 T C 3: 107,879,541 L11S probably damaging Het
Gsdme A G 6: 50,221,029 I317T possibly damaging Het
Itgad T C 7: 128,202,986 S979P probably damaging Het
Mga T C 2: 119,960,961 probably null Het
Nubpl T C 12: 52,310,687 probably benign Het
Olfr1105 T C 2: 87,033,774 Y149C probably damaging Het
Olfr124 T C 17: 37,806,000 L285P probably damaging Het
Pard3b G A 1: 61,639,315 E25K probably damaging Het
Phactr1 T A 13: 42,682,721 Y8* probably null Het
Phf14 T C 6: 11,953,317 S352P probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prap1 G T 7: 140,093,477 probably benign Het
Prdm8 T A 5: 98,185,260 F229I probably benign Het
Rfx6 T C 10: 51,677,840 F11L probably benign Het
Rfx8 T A 1: 39,718,405 probably benign Het
Rif1 C T 2: 52,111,117 R1528C probably damaging Het
Ripk4 G A 16: 97,763,518 probably benign Het
Satb1 T A 17: 51,740,203 I695F probably damaging Het
Sema4d A G 13: 51,705,257 probably benign Het
Suv39h2 T C 2: 3,464,916 Y134C probably damaging Het
Tcerg1 C T 18: 42,524,008 A185V unknown Het
Tep1 T A 14: 50,866,029 D268V probably damaging Het
Tmem89 T A 9: 108,915,417 V126D probably damaging Het
Trf T C 9: 103,220,922 T46A probably benign Het
Trmt6 C T 2: 132,806,769 R415Q possibly damaging Het
Trp53bp1 T C 2: 121,204,525 K1625E probably damaging Het
Zcchc4 T A 5: 52,807,078 I292N possibly damaging Het
Other mutations in Slc30a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Slc30a4 APN 2 122702388 missense possibly damaging 0.87
IGL01583:Slc30a4 APN 2 122685217 missense probably benign
IGL01823:Slc30a4 APN 2 122702092 missense probably damaging 1.00
IGL02086:Slc30a4 APN 2 122702027 splice site probably benign
F5770:Slc30a4 UTSW 2 122689538 missense probably benign 0.00
R0060:Slc30a4 UTSW 2 122685184 missense probably benign
R0373:Slc30a4 UTSW 2 122689399 missense probably damaging 0.99
R0591:Slc30a4 UTSW 2 122685240 missense probably damaging 1.00
R1514:Slc30a4 UTSW 2 122689414 missense probably damaging 1.00
R1552:Slc30a4 UTSW 2 122686016 missense probably benign 0.05
R3847:Slc30a4 UTSW 2 122702272 missense probably damaging 1.00
R4195:Slc30a4 UTSW 2 122685270 missense probably damaging 1.00
R4501:Slc30a4 UTSW 2 122685216 missense probably benign
R5558:Slc30a4 UTSW 2 122686983 missense probably damaging 1.00
R6379:Slc30a4 UTSW 2 122689549 missense probably damaging 1.00
R6393:Slc30a4 UTSW 2 122686046 missense probably damaging 1.00
V7580:Slc30a4 UTSW 2 122689538 missense probably benign 0.00
V7581:Slc30a4 UTSW 2 122689538 missense probably benign 0.00
V7582:Slc30a4 UTSW 2 122689538 missense probably benign 0.00
V7583:Slc30a4 UTSW 2 122689538 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGCTCATTCTGTAAACAGCACTCTG -3'
(R):5'- TGGGCTTAGAAACTGCCTTCTGC -3'

Sequencing Primer
(F):5'- CTGTAAACAGCACTCTGGAAGTTC -3'
(R):5'- CAGTAGAAGGGCTTAAGAGACATC -3'
Posted On2013-08-06