Incidental Mutation 'R0060:Trmt6'
ID64388
Institutional Source Beutler Lab
Gene Symbol Trmt6
Ensembl Gene ENSMUSG00000037376
Gene NametRNA methyltransferase 6
Synonyms3300001M20Rik
MMRRC Submission 038353-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.812) question?
Stock #R0060 (G1)
Quality Score112
Status Validated
Chromosome2
Chromosomal Location132804207-132816055 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 132806769 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 415 (R415Q)
Ref Sequence ENSEMBL: ENSMUSP00000044687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039554]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039554
AA Change: R415Q

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044687
Gene: ENSMUSG00000037376
AA Change: R415Q

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Gcd10p 20 302 7.2e-74 PFAM
coiled coil region 345 364 N/A INTRINSIC
low complexity region 444 456 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147336
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152836
Meta Mutation Damage Score 0.416 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tRNA methyltransferase 6 protein family. A similar protein in yeast is part of a two component methyltransferase, which is involved in the posttranslational modification that produces the modified nucleoside 1-methyladenosine in tRNAs. Modified 1-methyladenosine influences initiator methionine stability and may be involved in the replication of human immunodeficiency virus type 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A C 11: 58,422,182 probably benign Het
A630091E08Rik A G 7: 98,543,668 noncoding transcript Het
Abca8a T C 11: 110,070,480 T539A probably damaging Het
Ankrd60 A T 2: 173,572,613 M1K probably null Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Cabcoco1 A T 10: 68,533,862 probably null Het
Capn7 T C 14: 31,365,604 probably benign Het
Cd109 G A 9: 78,703,107 E1145K probably damaging Het
Celsr1 A T 15: 85,922,198 V2353D probably damaging Het
Cep350 C T 1: 155,928,626 D904N probably damaging Het
Chl1 T A 6: 103,711,058 probably benign Het
Colec10 G A 15: 54,439,146 probably benign Het
Cst11 T A 2: 148,770,402 Q105L probably damaging Het
Eps8l3 T C 3: 107,879,541 L11S probably damaging Het
Gsdme A G 6: 50,221,029 I317T possibly damaging Het
Itgad T C 7: 128,202,986 S979P probably damaging Het
Mga T C 2: 119,960,961 probably null Het
Nubpl T C 12: 52,310,687 probably benign Het
Olfr1105 T C 2: 87,033,774 Y149C probably damaging Het
Olfr124 T C 17: 37,806,000 L285P probably damaging Het
Pard3b G A 1: 61,639,315 E25K probably damaging Het
Phactr1 T A 13: 42,682,721 Y8* probably null Het
Phf14 T C 6: 11,953,317 S352P probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prap1 G T 7: 140,093,477 probably benign Het
Prdm8 T A 5: 98,185,260 F229I probably benign Het
Rfx6 T C 10: 51,677,840 F11L probably benign Het
Rfx8 T A 1: 39,718,405 probably benign Het
Rif1 C T 2: 52,111,117 R1528C probably damaging Het
Ripk4 G A 16: 97,763,518 probably benign Het
Satb1 T A 17: 51,740,203 I695F probably damaging Het
Sema4d A G 13: 51,705,257 probably benign Het
Slc30a4 T A 2: 122,685,184 T381S probably benign Het
Suv39h2 T C 2: 3,464,916 Y134C probably damaging Het
Tcerg1 C T 18: 42,524,008 A185V unknown Het
Tep1 T A 14: 50,866,029 D268V probably damaging Het
Tmem89 T A 9: 108,915,417 V126D probably damaging Het
Trf T C 9: 103,220,922 T46A probably benign Het
Trp53bp1 T C 2: 121,204,525 K1625E probably damaging Het
Zcchc4 T A 5: 52,807,078 I292N possibly damaging Het
Other mutations in Trmt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02314:Trmt6 APN 2 132805458 missense probably benign 0.01
IGL02604:Trmt6 APN 2 132810437 nonsense probably null
IGL03216:Trmt6 APN 2 132808698 missense probably null
IGL03231:Trmt6 APN 2 132815836 missense probably benign 0.01
R0060:Trmt6 UTSW 2 132806769 missense possibly damaging 0.84
R0086:Trmt6 UTSW 2 132809017 critical splice acceptor site probably benign
R0485:Trmt6 UTSW 2 132809030 splice site probably benign
R0827:Trmt6 UTSW 2 132815834 missense probably damaging 1.00
R1654:Trmt6 UTSW 2 132815835 missense possibly damaging 0.92
R1757:Trmt6 UTSW 2 132810237 missense probably damaging 0.96
R1974:Trmt6 UTSW 2 132811048 missense probably damaging 1.00
R2008:Trmt6 UTSW 2 132806909 nonsense probably null
R2310:Trmt6 UTSW 2 132808912 missense probably damaging 1.00
R4989:Trmt6 UTSW 2 132808271 missense possibly damaging 0.58
R5288:Trmt6 UTSW 2 132808783 missense probably benign 0.03
R5385:Trmt6 UTSW 2 132808783 missense probably benign 0.03
R5386:Trmt6 UTSW 2 132808783 missense probably benign 0.03
R6546:Trmt6 UTSW 2 132812153 missense probably benign 0.16
R6815:Trmt6 UTSW 2 132809858 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCCACTGTAAAACCGTGACTC -3'
(R):5'- TGGCTCACATTGGCCTAGTACTCC -3'

Sequencing Primer
(F):5'- ACCGTGACTCTATTTAAACAACG -3'
(R):5'- tgtgtagttccagccaacc -3'
Posted On2013-08-06