Incidental Mutation 'R0060:Gsdme'
ID64392
Institutional Source Beutler Lab
Gene Symbol Gsdme
Ensembl Gene ENSMUSG00000029821
Gene Namegasdermin E
Synonyms4932441K13Rik, Dfna5h, Dfna5, Fin15, 2310037D07Rik
MMRRC Submission 038353-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0060 (G1)
Quality Score111
Status Validated
Chromosome6
Chromosomal Location50188888-50263862 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50221029 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 317 (I317T)
Ref Sequence ENSEMBL: ENSMUSP00000126759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031845] [ENSMUST00000101405] [ENSMUST00000165099] [ENSMUST00000170142]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031845
AA Change: I317T

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031845
Gene: ENSMUSG00000029821
AA Change: I317T

DomainStartEndE-ValueType
Pfam:Gasdermin 1 473 4.8e-167 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000101405
AA Change: I317T

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000098952
Gene: ENSMUSG00000029821
AA Change: I317T

DomainStartEndE-ValueType
Pfam:Gasdermin 1 399 2e-126 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165099
AA Change: I317T

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000130522
Gene: ENSMUSG00000029821
AA Change: I317T

DomainStartEndE-ValueType
Pfam:Gasdermin 1 424 1.7e-136 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170142
AA Change: I317T

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126759
Gene: ENSMUSG00000029821
AA Change: I317T

DomainStartEndE-ValueType
Pfam:Gasdermin 1 473 2.3e-149 PFAM
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hearing impairment is a heterogeneous condition with over 40 loci described. The protein encoded by this gene is expressed in fetal cochlea, however, its function is not known. Nonsyndromic hearing impairment is associated with a mutation in this gene. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display abnormal numbers of cochlear hair cell but have normal hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A C 11: 58,422,182 probably benign Het
A630091E08Rik A G 7: 98,543,668 noncoding transcript Het
Abca8a T C 11: 110,070,480 T539A probably damaging Het
Ankrd60 A T 2: 173,572,613 M1K probably null Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Cabcoco1 A T 10: 68,533,862 probably null Het
Capn7 T C 14: 31,365,604 probably benign Het
Cd109 G A 9: 78,703,107 E1145K probably damaging Het
Celsr1 A T 15: 85,922,198 V2353D probably damaging Het
Cep350 C T 1: 155,928,626 D904N probably damaging Het
Chl1 T A 6: 103,711,058 probably benign Het
Colec10 G A 15: 54,439,146 probably benign Het
Cst11 T A 2: 148,770,402 Q105L probably damaging Het
Eps8l3 T C 3: 107,879,541 L11S probably damaging Het
Itgad T C 7: 128,202,986 S979P probably damaging Het
Mga T C 2: 119,960,961 probably null Het
Nubpl T C 12: 52,310,687 probably benign Het
Olfr1105 T C 2: 87,033,774 Y149C probably damaging Het
Olfr124 T C 17: 37,806,000 L285P probably damaging Het
Pard3b G A 1: 61,639,315 E25K probably damaging Het
Phactr1 T A 13: 42,682,721 Y8* probably null Het
Phf14 T C 6: 11,953,317 S352P probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prap1 G T 7: 140,093,477 probably benign Het
Prdm8 T A 5: 98,185,260 F229I probably benign Het
Rfx6 T C 10: 51,677,840 F11L probably benign Het
Rfx8 T A 1: 39,718,405 probably benign Het
Rif1 C T 2: 52,111,117 R1528C probably damaging Het
Ripk4 G A 16: 97,763,518 probably benign Het
Satb1 T A 17: 51,740,203 I695F probably damaging Het
Sema4d A G 13: 51,705,257 probably benign Het
Slc30a4 T A 2: 122,685,184 T381S probably benign Het
Suv39h2 T C 2: 3,464,916 Y134C probably damaging Het
Tcerg1 C T 18: 42,524,008 A185V unknown Het
Tep1 T A 14: 50,866,029 D268V probably damaging Het
Tmem89 T A 9: 108,915,417 V126D probably damaging Het
Trf T C 9: 103,220,922 T46A probably benign Het
Trmt6 C T 2: 132,806,769 R415Q possibly damaging Het
Trp53bp1 T C 2: 121,204,525 K1625E probably damaging Het
Zcchc4 T A 5: 52,807,078 I292N possibly damaging Het
Other mutations in Gsdme
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Gsdme APN 6 50229284 critical splice donor site probably null
IGL01462:Gsdme APN 6 50227374 missense possibly damaging 0.94
IGL01645:Gsdme APN 6 50251336 missense probably damaging 1.00
IGL01836:Gsdme APN 6 50222789 missense probably damaging 1.00
R0060:Gsdme UTSW 6 50221029 missense possibly damaging 0.73
R0110:Gsdme UTSW 6 50246127 splice site probably benign
R0396:Gsdme UTSW 6 50221107 missense probably benign 0.00
R0510:Gsdme UTSW 6 50246127 splice site probably benign
R0627:Gsdme UTSW 6 50229279 splice site probably benign
R1350:Gsdme UTSW 6 50246128 splice site probably null
R1992:Gsdme UTSW 6 50208122 missense probably damaging 1.00
R2869:Gsdme UTSW 6 50208177 nonsense probably null
R2869:Gsdme UTSW 6 50208177 nonsense probably null
R2973:Gsdme UTSW 6 50229324 missense probably damaging 1.00
R2974:Gsdme UTSW 6 50229324 missense probably damaging 1.00
R3154:Gsdme UTSW 6 50251363 missense probably damaging 0.99
R3816:Gsdme UTSW 6 50219411 missense probably benign 0.41
R3818:Gsdme UTSW 6 50219411 missense probably benign 0.41
R3819:Gsdme UTSW 6 50219411 missense probably benign 0.41
R4035:Gsdme UTSW 6 50229448 missense possibly damaging 0.50
R4519:Gsdme UTSW 6 50229353 missense probably damaging 1.00
R4669:Gsdme UTSW 6 50208122 missense probably damaging 1.00
R4678:Gsdme UTSW 6 50229324 missense possibly damaging 0.87
R5009:Gsdme UTSW 6 50246012 missense possibly damaging 0.64
R5370:Gsdme UTSW 6 50229306 missense probably damaging 0.98
R5768:Gsdme UTSW 6 50219300 nonsense probably null
R5811:Gsdme UTSW 6 50245945 missense probably benign 0.02
R5975:Gsdme UTSW 6 50227359 missense probably benign 0.30
R6032:Gsdme UTSW 6 50245954 missense probably damaging 1.00
R6032:Gsdme UTSW 6 50245954 missense probably damaging 1.00
R6035:Gsdme UTSW 6 50229326 missense probably damaging 0.99
R6035:Gsdme UTSW 6 50229326 missense probably damaging 0.99
R6089:Gsdme UTSW 6 50251305 missense probably damaging 0.99
R6565:Gsdme UTSW 6 50229449 missense probably damaging 0.97
R6862:Gsdme UTSW 6 50227398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTGTGAGCTGAATCCATGCCC -3'
(R):5'- CCTTTGGAAGGAACTGGTGACTGAG -3'

Sequencing Primer
(F):5'- gaccgagataagccaccag -3'
(R):5'- CTGGTGACTGAGAGGCAGG -3'
Posted On2013-08-06