Incidental Mutation 'R0068:Tas2r123'
ID64416
Institutional Source Beutler Lab
Gene Symbol Tas2r123
Ensembl Gene ENSMUSG00000057381
Gene Nametaste receptor, type 2, member 123
Synonymsmt2r55, Tas2r23, STC 9-2, mGR23, T2R23
MMRRC Submission 038359-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R0068 (G1)
Quality Score83
Status Validated
Chromosome6
Chromosomal Location132847142-132848143 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132847992 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 284 (I284T)
Ref Sequence ENSEMBL: ENSMUSP00000071615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071696]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071696
AA Change: I284T

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000071615
Gene: ENSMUSG00000057381
AA Change: I284T

DomainStartEndE-ValueType
Pfam:TAS2R 7 322 4.6e-79 PFAM
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 92.6%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,952,221 T1675A probably benign Het
Abca6 T C 11: 110,182,882 T1448A probably damaging Het
Aldoart2 G T 12: 55,565,448 E53* probably null Het
Ankra2 C T 13: 98,273,383 Q137* probably null Het
Arpc1a C T 5: 145,091,244 T21I possibly damaging Het
Arvcf T C 16: 18,396,954 probably benign Het
Ash1l C A 3: 89,007,317 S1751R probably benign Het
Bsn C A 9: 108,112,137 G2139C probably damaging Het
Ccdc148 T C 2: 58,827,617 E530G probably benign Het
Cct3 A G 3: 88,318,465 D365G probably benign Het
Chd2 A T 7: 73,484,534 S688R probably damaging Het
Crispld1 A G 1: 17,752,988 T398A possibly damaging Het
Ctbp2 A C 7: 132,990,059 V906G possibly damaging Het
Cwf19l1 A T 19: 44,131,499 Y68N probably damaging Het
Dlc1 T A 8: 36,937,721 M305L probably benign Het
Dnm1l C A 16: 16,324,019 G288C probably damaging Het
Fignl2 A T 15: 101,054,248 I51N probably damaging Het
Flnb A G 14: 7,915,290 N1474D possibly damaging Het
Ghrhr C T 6: 55,380,864 probably benign Het
Gm11639 T C 11: 104,720,822 S497P probably benign Het
Hltf G A 3: 20,059,090 R9H probably damaging Het
Hps5 A G 7: 46,777,042 probably benign Het
Itpr3 T C 17: 27,104,060 probably benign Het
Kansl1l A G 1: 66,720,888 V911A probably benign Het
Kdm3b C T 18: 34,824,774 T1064I probably benign Het
Lrriq1 T A 10: 103,063,418 Q1654L probably benign Het
Ltbp1 A G 17: 75,359,409 T1366A probably damaging Het
Mroh1 A G 15: 76,446,692 probably benign Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Napb G A 2: 148,698,923 probably benign Het
Npc1 G C 18: 12,208,367 P532A probably benign Het
Nrp2 G T 1: 62,745,377 K228N possibly damaging Het
Olfr275 T A 4: 52,825,503 Y35* probably null Het
Plekhg1 A T 10: 3,940,504 K241* probably null Het
Poln T C 5: 34,077,088 probably benign Het
Ppil1 A T 17: 29,252,256 F92I probably damaging Het
Ppp1r9b T G 11: 95,001,220 F154V probably damaging Het
Ptchd3 T G 11: 121,842,972 L896R probably damaging Het
Rev3l A G 10: 39,824,831 N1775D possibly damaging Het
Rusc2 T C 4: 43,424,100 probably benign Het
Selenbp2 T C 3: 94,703,509 V294A probably benign Het
Slc25a48 T C 13: 56,451,211 V118A probably damaging Het
Slc38a10 T C 11: 120,134,853 D219G probably damaging Het
Slc38a2 C T 15: 96,691,292 probably null Het
Slc39a12 A G 2: 14,435,678 E480G probably benign Het
Tab2 C A 10: 7,919,677 R347L probably damaging Het
Tnks1bp1 T A 2: 85,062,352 D212E probably benign Het
Trim67 T C 8: 124,794,568 V223A probably damaging Het
Ugcg A G 4: 59,217,130 D218G probably benign Het
Vmn2r59 A G 7: 42,046,301 L229S probably damaging Het
Zfp451 A T 1: 33,777,625 L198I probably damaging Het
Other mutations in Tas2r123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Tas2r123 APN 6 132847406 missense probably benign 0.01
IGL01547:Tas2r123 APN 6 132847458 missense probably damaging 1.00
IGL02576:Tas2r123 APN 6 132847740 missense possibly damaging 0.96
IGL03303:Tas2r123 APN 6 132847438 missense probably damaging 1.00
R0068:Tas2r123 UTSW 6 132847992 missense possibly damaging 0.66
R0110:Tas2r123 UTSW 6 132847332 missense probably benign 0.01
R0364:Tas2r123 UTSW 6 132847681 missense probably benign
R0415:Tas2r123 UTSW 6 132847838 missense probably damaging 0.97
R0469:Tas2r123 UTSW 6 132847332 missense probably benign 0.01
R1791:Tas2r123 UTSW 6 132847565 missense probably damaging 1.00
R1976:Tas2r123 UTSW 6 132847332 missense probably damaging 0.96
R2328:Tas2r123 UTSW 6 132847316 missense probably benign 0.02
R4282:Tas2r123 UTSW 6 132848045 missense possibly damaging 0.75
R4283:Tas2r123 UTSW 6 132848045 missense possibly damaging 0.75
R4939:Tas2r123 UTSW 6 132847845 missense probably benign 0.32
R5079:Tas2r123 UTSW 6 132847718 missense probably benign 0.01
R5241:Tas2r123 UTSW 6 132847218 missense probably benign 0.06
R5288:Tas2r123 UTSW 6 132847227 missense probably benign 0.17
R5851:Tas2r123 UTSW 6 132847308 missense probably damaging 1.00
R6725:Tas2r123 UTSW 6 132847838 missense probably damaging 0.97
R6895:Tas2r123 UTSW 6 132847170 missense probably benign
R7017:Tas2r123 UTSW 6 132847550 missense probably benign 0.00
R7183:Tas2r123 UTSW 6 132847698 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCTCATCTTCTCACTGTGGAAGCAT -3'
(R):5'- TACTCCCAGGATTGAAGCCCCACT -3'

Sequencing Primer
(F):5'- TCACTGTGGAAGCATCACAAAAAG -3'
(R):5'- GGATTGAAGCCCCACTTTTTATTTTC -3'
Posted On2013-08-06