Incidental Mutation 'R0026:Ttf1'
ID64488
Institutional Source Beutler Lab
Gene Symbol Ttf1
Ensembl Gene ENSMUSG00000026803
Gene Nametranscription termination factor, RNA polymerase I
Synonyms
MMRRC Submission 038321-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.694) question?
Stock #R0026 (G1)
Quality Score89
Status Validated
Chromosome2
Chromosomal Location29060262-29087656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29071349 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 583 (I583N)
Ref Sequence ENSEMBL: ENSMUSP00000097809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100237]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100237
AA Change: I583N

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097809
Gene: ENSMUSG00000026803
AA Change: I583N

DomainStartEndE-ValueType
internal_repeat_1 13 67 1.04e-14 PROSPERO
internal_repeat_1 85 142 1.04e-14 PROSPERO
low complexity region 143 153 N/A INTRINSIC
low complexity region 171 183 N/A INTRINSIC
low complexity region 274 293 N/A INTRINSIC
low complexity region 350 387 N/A INTRINSIC
low complexity region 434 447 N/A INTRINSIC
low complexity region 451 461 N/A INTRINSIC
Blast:SANT 508 585 8e-28 BLAST
SANT 589 636 2.37e-6 SMART
SANT 638 720 1.8e-6 SMART
low complexity region 805 819 N/A INTRINSIC
low complexity region 842 857 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122866
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142786
Meta Mutation Damage Score 0.1028 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 93% (70/75)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,066,805 I585N possibly damaging Het
4931408C20Rik T A 1: 26,683,369 D910V probably benign Het
A830005F24Rik C T 13: 48,514,372 probably benign Het
Abca16 C T 7: 120,477,923 probably benign Het
Acot10 G A 15: 20,666,236 L140F probably benign Het
Adam19 G T 11: 46,136,259 C573F probably damaging Het
Aff3 A G 1: 38,203,893 S948P probably benign Het
Anxa3 T A 5: 96,838,401 Y300N probably benign Het
BC016579 T C 16: 45,640,367 T113A probably benign Het
Bmpr1b A G 3: 141,870,733 L113P probably benign Het
Casq1 T C 1: 172,219,400 probably benign Het
Cdc16 T A 8: 13,759,130 probably null Het
Cep135 C T 5: 76,606,734 R353* probably null Het
Cma1 A T 14: 55,942,164 C188S probably damaging Het
Csf3r A G 4: 126,031,884 T151A probably benign Het
Cyp4b1 C T 4: 115,647,521 G56D possibly damaging Het
Dbn1 T C 13: 55,477,784 E275G probably damaging Het
Dlgap2 C T 8: 14,727,363 Q203* probably null Het
Ephb3 A G 16: 21,214,917 D251G probably damaging Het
Fancd2os G T 6: 113,597,691 T118N probably damaging Het
Gm10801 T C 2: 98,663,909 probably benign Het
Got1l1 C T 8: 27,200,248 V132I probably benign Het
H2-M9 T C 17: 36,641,527 probably benign Het
Ibtk A G 9: 85,690,303 V1278A probably benign Het
Kctd3 T C 1: 188,976,621 T519A probably damaging Het
Lgsn T A 1: 31,203,443 V202D probably damaging Het
Madd A G 2: 91,175,708 F381L possibly damaging Het
Map1s G A 8: 70,914,638 G729D probably damaging Het
Mlycd A G 8: 119,410,435 I465V probably benign Het
Mrgprb1 T C 7: 48,447,204 R108G possibly damaging Het
Mrgprx2 T A 7: 48,482,023 H106L possibly damaging Het
Ncor1 T C 11: 62,438,429 Y6C probably damaging Het
Nfkb1 T C 3: 135,591,573 D773G probably damaging Het
Nxnl1 A G 8: 71,566,573 S3P probably damaging Het
Olfr109 T A 17: 37,466,803 V199D probably damaging Het
Olfr921 G A 9: 38,775,596 V114I probably benign Het
Otud7a T C 7: 63,735,801 F338L probably benign Het
Pdcl3 T A 1: 38,991,280 L14Q probably damaging Het
Pla2g7 T A 17: 43,594,930 probably benign Het
Prpf31 T A 7: 3,639,668 N413K probably benign Het
Rapgef5 T C 12: 117,689,161 S307P probably benign Het
Relt C A 7: 100,850,221 E164* probably null Het
Rnf185 T C 11: 3,426,617 D86G probably damaging Het
Rrm2b T C 15: 37,953,741 E21G probably benign Het
Scn5a A G 9: 119,522,566 I783T probably damaging Het
Senp1 T C 15: 98,076,668 R88G probably damaging Het
Skint5 A T 4: 113,546,468 probably benign Het
Slc35b1 T C 11: 95,390,642 S294P probably benign Het
Slc5a2 T A 7: 128,270,053 I335N probably damaging Het
Sstr1 T A 12: 58,212,858 M89K probably damaging Het
Szt2 A T 4: 118,384,772 S1612R possibly damaging Het
Taf1c T C 8: 119,604,236 probably null Het
Taf1d T A 9: 15,308,648 S64R probably damaging Het
Tmem125 A G 4: 118,542,073 S54P possibly damaging Het
Uchl4 A T 9: 64,235,371 probably null Het
Unc5b A T 10: 60,774,592 I482N possibly damaging Het
Unc80 C A 1: 66,521,584 Q824K probably benign Het
Utrn T C 10: 12,726,196 probably benign Het
Vmn2r61 T G 7: 42,275,474 I484R possibly damaging Het
Vps13b T C 15: 35,923,301 I3774T possibly damaging Het
Yipf1 T A 4: 107,345,160 L240* probably null Het
Other mutations in Ttf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Ttf1 APN 2 29073883 splice site probably benign
IGL00916:Ttf1 APN 2 29070042 missense probably benign 0.05
IGL02148:Ttf1 APN 2 29079426 missense probably benign 0.17
IGL02631:Ttf1 APN 2 29069900 missense probably damaging 0.98
IGL02658:Ttf1 APN 2 29074011 missense probably damaging 1.00
IGL03057:Ttf1 APN 2 29071345 missense probably damaging 0.98
R0047:Ttf1 UTSW 2 29084655 missense probably damaging 1.00
R0047:Ttf1 UTSW 2 29084655 missense probably damaging 1.00
R0427:Ttf1 UTSW 2 29065042 missense probably benign 0.00
R0466:Ttf1 UTSW 2 29065407 missense possibly damaging 0.79
R0834:Ttf1 UTSW 2 29073950 nonsense probably null
R1548:Ttf1 UTSW 2 29065138 missense probably damaging 0.96
R1672:Ttf1 UTSW 2 29067152 missense probably damaging 0.98
R1696:Ttf1 UTSW 2 29070002 missense probably damaging 1.00
R1819:Ttf1 UTSW 2 29074784 missense possibly damaging 0.60
R2000:Ttf1 UTSW 2 29065185 missense possibly damaging 0.79
R2126:Ttf1 UTSW 2 29071345 missense probably damaging 0.98
R2426:Ttf1 UTSW 2 29067185 missense probably damaging 0.98
R2967:Ttf1 UTSW 2 29065383 missense possibly damaging 0.56
R3499:Ttf1 UTSW 2 29065487 missense possibly damaging 0.92
R3963:Ttf1 UTSW 2 29064804 missense possibly damaging 0.68
R4342:Ttf1 UTSW 2 29065476 missense probably benign 0.01
R4627:Ttf1 UTSW 2 29065160 missense possibly damaging 0.72
R4676:Ttf1 UTSW 2 29074594 missense probably damaging 0.96
R4907:Ttf1 UTSW 2 29064656 missense possibly damaging 0.72
R4909:Ttf1 UTSW 2 29064656 missense possibly damaging 0.72
R4926:Ttf1 UTSW 2 29064656 missense possibly damaging 0.72
R4927:Ttf1 UTSW 2 29064656 missense possibly damaging 0.72
R5746:Ttf1 UTSW 2 29065742 missense probably damaging 0.96
R5948:Ttf1 UTSW 2 29073920 missense possibly damaging 0.50
R6911:Ttf1 UTSW 2 29064851 missense probably benign 0.41
X0066:Ttf1 UTSW 2 29074775 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GCACACTGCTGCACATGACTTAAC -3'
(R):5'- GTGCTGAAGCCCAGGTACAAAGATAC -3'

Sequencing Primer
(F):5'- TTAACCATGTCACGCAGGG -3'
(R):5'- CCACAAGGCTTATTAAAGAACTGG -3'
Posted On2013-08-06