Incidental Mutation 'R0026:Nxnl1'
ID64497
Institutional Source Beutler Lab
Gene Symbol Nxnl1
Ensembl Gene ENSMUSG00000034829
Gene Namenucleoredoxin-like 1
SynonymsRdCVF, A930031O08Rik, Txnl6
MMRRC Submission 038321-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.037) question?
Stock #R0026 (G1)
Quality Score102
Status Validated
Chromosome8
Chromosomal Location71560555-71566601 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71566573 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 3 (S3P)
Ref Sequence ENSEMBL: ENSMUSP00000127094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034267] [ENSMUST00000048243] [ENSMUST00000163659] [ENSMUST00000212111] [ENSMUST00000212889] [ENSMUST00000213100]
Predicted Effect probably benign
Transcript: ENSMUST00000034267
SMART Domains Protein: ENSMUSP00000034267
Gene: ENSMUSG00000031808

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:AMP-binding 82 515 2.1e-71 PFAM
Pfam:AMP-binding_C 523 598 2.9e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000048243
AA Change: S3P

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000039294
Gene: ENSMUSG00000034829
AA Change: S3P

DomainStartEndE-ValueType
Pfam:Thioredoxin_8 32 132 2.8e-24 PFAM
low complexity region 187 202 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163659
AA Change: S3P

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127094
Gene: ENSMUSG00000034829
AA Change: S3P

DomainStartEndE-ValueType
Pfam:Thioredoxin_8 32 132 1.5e-22 PFAM
low complexity region 187 202 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211886
Predicted Effect probably benign
Transcript: ENSMUST00000212111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212225
Predicted Effect probably benign
Transcript: ENSMUST00000212889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212989
Predicted Effect probably benign
Transcript: ENSMUST00000213100
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 93% (70/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Retinitis pigmentosa (RP) is a disease that leads to blindness by degeneration of cone photoreceptors. Rods produce factors required for cone viability. The protein encoded by this gene is one of those factors and is similar to a truncated form of thioredoxin. This gene has been proposed to have therapeutic value against RP. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a kncok-out allele exhibit reduced cone numbers, thin outer nuclear layer, impaired visibility and increased vulnerability to hyperoxia-induced damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,066,805 I585N possibly damaging Het
4931408C20Rik T A 1: 26,683,369 D910V probably benign Het
A830005F24Rik C T 13: 48,514,372 probably benign Het
Abca16 C T 7: 120,477,923 probably benign Het
Acot10 G A 15: 20,666,236 L140F probably benign Het
Adam19 G T 11: 46,136,259 C573F probably damaging Het
Aff3 A G 1: 38,203,893 S948P probably benign Het
Anxa3 T A 5: 96,838,401 Y300N probably benign Het
BC016579 T C 16: 45,640,367 T113A probably benign Het
Bmpr1b A G 3: 141,870,733 L113P probably benign Het
Casq1 T C 1: 172,219,400 probably benign Het
Cdc16 T A 8: 13,759,130 probably null Het
Cep135 C T 5: 76,606,734 R353* probably null Het
Cma1 A T 14: 55,942,164 C188S probably damaging Het
Csf3r A G 4: 126,031,884 T151A probably benign Het
Cyp4b1 C T 4: 115,647,521 G56D possibly damaging Het
Dbn1 T C 13: 55,477,784 E275G probably damaging Het
Dlgap2 C T 8: 14,727,363 Q203* probably null Het
Ephb3 A G 16: 21,214,917 D251G probably damaging Het
Fancd2os G T 6: 113,597,691 T118N probably damaging Het
Gm10801 T C 2: 98,663,909 probably benign Het
Got1l1 C T 8: 27,200,248 V132I probably benign Het
H2-M9 T C 17: 36,641,527 probably benign Het
Ibtk A G 9: 85,690,303 V1278A probably benign Het
Kctd3 T C 1: 188,976,621 T519A probably damaging Het
Lgsn T A 1: 31,203,443 V202D probably damaging Het
Madd A G 2: 91,175,708 F381L possibly damaging Het
Map1s G A 8: 70,914,638 G729D probably damaging Het
Mlycd A G 8: 119,410,435 I465V probably benign Het
Mrgprb1 T C 7: 48,447,204 R108G possibly damaging Het
Mrgprx2 T A 7: 48,482,023 H106L possibly damaging Het
Ncor1 T C 11: 62,438,429 Y6C probably damaging Het
Nfkb1 T C 3: 135,591,573 D773G probably damaging Het
Olfr109 T A 17: 37,466,803 V199D probably damaging Het
Olfr921 G A 9: 38,775,596 V114I probably benign Het
Otud7a T C 7: 63,735,801 F338L probably benign Het
Pdcl3 T A 1: 38,991,280 L14Q probably damaging Het
Pla2g7 T A 17: 43,594,930 probably benign Het
Prpf31 T A 7: 3,639,668 N413K probably benign Het
Rapgef5 T C 12: 117,689,161 S307P probably benign Het
Relt C A 7: 100,850,221 E164* probably null Het
Rnf185 T C 11: 3,426,617 D86G probably damaging Het
Rrm2b T C 15: 37,953,741 E21G probably benign Het
Scn5a A G 9: 119,522,566 I783T probably damaging Het
Senp1 T C 15: 98,076,668 R88G probably damaging Het
Skint5 A T 4: 113,546,468 probably benign Het
Slc35b1 T C 11: 95,390,642 S294P probably benign Het
Slc5a2 T A 7: 128,270,053 I335N probably damaging Het
Sstr1 T A 12: 58,212,858 M89K probably damaging Het
Szt2 A T 4: 118,384,772 S1612R possibly damaging Het
Taf1c T C 8: 119,604,236 probably null Het
Taf1d T A 9: 15,308,648 S64R probably damaging Het
Tmem125 A G 4: 118,542,073 S54P possibly damaging Het
Ttf1 T A 2: 29,071,349 I583N possibly damaging Het
Uchl4 A T 9: 64,235,371 probably null Het
Unc5b A T 10: 60,774,592 I482N possibly damaging Het
Unc80 C A 1: 66,521,584 Q824K probably benign Het
Utrn T C 10: 12,726,196 probably benign Het
Vmn2r61 T G 7: 42,275,474 I484R possibly damaging Het
Vps13b T C 15: 35,923,301 I3774T possibly damaging Het
Yipf1 T A 4: 107,345,160 L240* probably null Het
Predicted Primers PCR Primer
(F):5'- AGCACGTAGAACTCGTCAGTGAGC -3'
(R):5'- TTGCAGTGATCCTTCTGCCACAG -3'

Sequencing Primer
(F):5'- CCGCACGAAGAAGTCTTTGAG -3'
(R):5'- GCTCAGACTCTGTTTTGTTAGTATC -3'
Posted On2013-08-06