Incidental Mutation 'R0026:Pla2g7'
ID64508
Institutional Source Beutler Lab
Gene Symbol Pla2g7
Ensembl Gene ENSMUSG00000023913
Gene Namephospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma)
SynonymsPAF acetylhydrolase
MMRRC Submission 038321-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.409) question?
Stock #R0026 (G1)
Quality Score149
Status Validated
Chromosome17
Chromosomal Location43568098-43612201 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 43594930 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024706] [ENSMUST00000167214] [ENSMUST00000167418] [ENSMUST00000169694]
Predicted Effect probably benign
Transcript: ENSMUST00000024706
SMART Domains Protein: ENSMUSP00000024706
Gene: ENSMUSG00000023913

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:PAF-AH_p_II 47 415 6e-179 PFAM
Pfam:Abhydrolase_5 145 351 3.2e-18 PFAM
Pfam:Abhydrolase_1 215 318 2.8e-7 PFAM
Pfam:Peptidase_S9 247 356 2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164150
Predicted Effect probably benign
Transcript: ENSMUST00000167214
SMART Domains Protein: ENSMUSP00000130404
Gene: ENSMUSG00000023913

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:PAF-AH_p_II 47 210 7.9e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167418
SMART Domains Protein: ENSMUSP00000131898
Gene: ENSMUSG00000023913

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:PAF-AH_p_II 47 122 1e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167672
Predicted Effect probably benign
Transcript: ENSMUST00000169694
SMART Domains Protein: ENSMUSP00000132027
Gene: ENSMUSG00000023913

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:PAF-AH_p_II 47 298 6.1e-120 PFAM
Pfam:Abhydrolase_5 145 298 1.4e-15 PFAM
Pfam:Abhydrolase_6 146 298 4.5e-11 PFAM
Pfam:Peptidase_S9 246 298 4.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172072
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 93% (70/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted enzyme that catalyzes the degradation of platelet-activating factor to biologically inactive products. Defects in this gene are a cause of platelet-activating factor acetylhydrolase deficiency. Two transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced early mortality in response to bacterial exposure, formula feeding and asphyxia, but survivors show a significantly higher incidence of necrotizing enterocolitis relative to wild-type controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,066,805 I585N possibly damaging Het
4931408C20Rik T A 1: 26,683,369 D910V probably benign Het
A830005F24Rik C T 13: 48,514,372 probably benign Het
Abca16 C T 7: 120,477,923 probably benign Het
Acot10 G A 15: 20,666,236 L140F probably benign Het
Adam19 G T 11: 46,136,259 C573F probably damaging Het
Aff3 A G 1: 38,203,893 S948P probably benign Het
Anxa3 T A 5: 96,838,401 Y300N probably benign Het
BC016579 T C 16: 45,640,367 T113A probably benign Het
Bmpr1b A G 3: 141,870,733 L113P probably benign Het
Casq1 T C 1: 172,219,400 probably benign Het
Cdc16 T A 8: 13,759,130 probably null Het
Cep135 C T 5: 76,606,734 R353* probably null Het
Cma1 A T 14: 55,942,164 C188S probably damaging Het
Csf3r A G 4: 126,031,884 T151A probably benign Het
Cyp4b1 C T 4: 115,647,521 G56D possibly damaging Het
Dbn1 T C 13: 55,477,784 E275G probably damaging Het
Dlgap2 C T 8: 14,727,363 Q203* probably null Het
Ephb3 A G 16: 21,214,917 D251G probably damaging Het
Fancd2os G T 6: 113,597,691 T118N probably damaging Het
Gm10801 T C 2: 98,663,909 probably benign Het
Got1l1 C T 8: 27,200,248 V132I probably benign Het
H2-M9 T C 17: 36,641,527 probably benign Het
Ibtk A G 9: 85,690,303 V1278A probably benign Het
Kctd3 T C 1: 188,976,621 T519A probably damaging Het
Lgsn T A 1: 31,203,443 V202D probably damaging Het
Madd A G 2: 91,175,708 F381L possibly damaging Het
Map1s G A 8: 70,914,638 G729D probably damaging Het
Mlycd A G 8: 119,410,435 I465V probably benign Het
Mrgprb1 T C 7: 48,447,204 R108G possibly damaging Het
Mrgprx2 T A 7: 48,482,023 H106L possibly damaging Het
Ncor1 T C 11: 62,438,429 Y6C probably damaging Het
Nfkb1 T C 3: 135,591,573 D773G probably damaging Het
Nxnl1 A G 8: 71,566,573 S3P probably damaging Het
Olfr109 T A 17: 37,466,803 V199D probably damaging Het
Olfr921 G A 9: 38,775,596 V114I probably benign Het
Otud7a T C 7: 63,735,801 F338L probably benign Het
Pdcl3 T A 1: 38,991,280 L14Q probably damaging Het
Prpf31 T A 7: 3,639,668 N413K probably benign Het
Rapgef5 T C 12: 117,689,161 S307P probably benign Het
Relt C A 7: 100,850,221 E164* probably null Het
Rnf185 T C 11: 3,426,617 D86G probably damaging Het
Rrm2b T C 15: 37,953,741 E21G probably benign Het
Scn5a A G 9: 119,522,566 I783T probably damaging Het
Senp1 T C 15: 98,076,668 R88G probably damaging Het
Skint5 A T 4: 113,546,468 probably benign Het
Slc35b1 T C 11: 95,390,642 S294P probably benign Het
Slc5a2 T A 7: 128,270,053 I335N probably damaging Het
Sstr1 T A 12: 58,212,858 M89K probably damaging Het
Szt2 A T 4: 118,384,772 S1612R possibly damaging Het
Taf1c T C 8: 119,604,236 probably null Het
Taf1d T A 9: 15,308,648 S64R probably damaging Het
Tmem125 A G 4: 118,542,073 S54P possibly damaging Het
Ttf1 T A 2: 29,071,349 I583N possibly damaging Het
Uchl4 A T 9: 64,235,371 probably null Het
Unc5b A T 10: 60,774,592 I482N possibly damaging Het
Unc80 C A 1: 66,521,584 Q824K probably benign Het
Utrn T C 10: 12,726,196 probably benign Het
Vmn2r61 T G 7: 42,275,474 I484R possibly damaging Het
Vps13b T C 15: 35,923,301 I3774T possibly damaging Het
Yipf1 T A 4: 107,345,160 L240* probably null Het
Other mutations in Pla2g7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Pla2g7 APN 17 43602871 missense probably damaging 1.00
R0421:Pla2g7 UTSW 17 43611412 missense probably damaging 0.96
R1701:Pla2g7 UTSW 17 43600524 missense probably damaging 1.00
R4591:Pla2g7 UTSW 17 43600559 missense probably damaging 0.98
R5100:Pla2g7 UTSW 17 43611376 missense probably damaging 1.00
R5713:Pla2g7 UTSW 17 43594292 missense probably benign 0.03
R6404:Pla2g7 UTSW 17 43594797 missense probably damaging 1.00
R6433:Pla2g7 UTSW 17 43599126 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCCAACAGAGCGTCTTCGTG -3'
(R):5'- AAAGGACCTTTGCTTCCCTCAGTG -3'

Sequencing Primer
(F):5'- GTGCGTTTGTACTACCCAGC -3'
(R):5'- aaaaacaccaggcacacac -3'
Posted On2013-08-06