Incidental Mutation 'R0030:Eps15l1'
ID64525
Institutional Source Beutler Lab
Gene Symbol Eps15l1
Ensembl Gene ENSMUSG00000006276
Gene Nameepidermal growth factor receptor pathway substrate 15-like 1
Synonyms9830147J04Rik, Eps15-rs, Eps15R
MMRRC Submission 038324-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R0030 (G1)
Quality Score113
Status Not validated
Chromosome8
Chromosomal Location72340999-72421460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72373050 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 646 (S646P)
Ref Sequence ENSEMBL: ENSMUSP00000129739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163643] [ENSMUST00000212121] [ENSMUST00000212590]
Predicted Effect probably benign
Transcript: ENSMUST00000163643
AA Change: S646P

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000129739
Gene: ENSMUSG00000006276
AA Change: S646P

DomainStartEndE-ValueType
EH 8 103 1.45e-21 SMART
EFh 52 80 6.56e0 SMART
EH 120 214 6.1e-47 SMART
EFh 163 191 4.35e-2 SMART
low complexity region 241 255 N/A INTRINSIC
EH 266 362 5.08e-44 SMART
EFh 276 304 1.09e0 SMART
coiled coil region 381 564 N/A INTRINSIC
internal_repeat_2 615 656 1.56e-6 PROSPERO
low complexity region 661 678 N/A INTRINSIC
low complexity region 701 722 N/A INTRINSIC
low complexity region 728 743 N/A INTRINSIC
low complexity region 746 764 N/A INTRINSIC
low complexity region 775 790 N/A INTRINSIC
internal_repeat_2 809 839 1.56e-6 PROSPERO
low complexity region 840 853 N/A INTRINSIC
UIM 863 882 3.98e1 SMART
UIM 889 907 3.76e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212121
AA Change: S615P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212257
Predicted Effect probably benign
Transcript: ENSMUST00000212590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212950
Meta Mutation Damage Score 0.1272 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 T A 1: 89,888,744 Y755* probably null Het
Ahctf1 G A 1: 179,752,436 T2067M probably damaging Het
Ank1 C A 8: 23,093,893 D337E probably damaging Het
Ankrd65 A C 4: 155,791,485 R72S probably damaging Het
Cacna1s T C 1: 136,094,989 probably null Het
Cyp4f40 T C 17: 32,675,973 S462P probably damaging Het
Dxo A G 17: 34,837,938 R132G probably damaging Het
Foxi2 A G 7: 135,411,616 T192A probably damaging Het
Fry T A 5: 150,372,569 C480* probably null Het
Gak C T 5: 108,613,547 W206* probably null Het
Ggt7 G T 2: 155,506,488 D5E probably benign Het
Hectd4 G T 5: 121,262,588 G339* probably null Het
Ikzf3 T C 11: 98,467,612 T300A probably benign Het
Med12l T G 3: 59,248,655 L1198R probably damaging Het
Odf4 T A 11: 68,926,941 E9D probably benign Het
Olfr1395 T A 11: 49,149,040 M261K possibly damaging Het
Pax1 C A 2: 147,368,582 F412L probably damaging Het
Polg A T 7: 79,452,128 I1006N probably damaging Het
Ppp4c A G 7: 126,788,433 V51A possibly damaging Het
Scn10a G C 9: 119,669,990 T304R probably benign Het
Scp2 T A 4: 108,107,690 probably null Het
Ubr4 G T 4: 139,426,793 V2104L probably damaging Het
Other mutations in Eps15l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Eps15l1 APN 8 72384838 nonsense probably null
IGL01316:Eps15l1 APN 8 72389414 missense possibly damaging 0.66
IGL01344:Eps15l1 APN 8 72382325 critical splice donor site probably null
IGL01918:Eps15l1 APN 8 72367912 missense possibly damaging 0.49
IGL01982:Eps15l1 APN 8 72379075 missense probably benign 0.28
IGL02305:Eps15l1 APN 8 72387009 missense probably null 1.00
IGL02939:Eps15l1 APN 8 72384762 splice site probably benign
IGL02951:Eps15l1 APN 8 72358396 missense probably benign 0.19
R0025:Eps15l1 UTSW 8 72381497 splice site probably benign
R0025:Eps15l1 UTSW 8 72381497 splice site probably benign
R0030:Eps15l1 UTSW 8 72373050 missense probably benign 0.03
R0799:Eps15l1 UTSW 8 72346085 missense probably damaging 0.99
R1300:Eps15l1 UTSW 8 72391902 missense probably damaging 0.99
R2131:Eps15l1 UTSW 8 72386868 missense probably benign 0.05
R2132:Eps15l1 UTSW 8 72386868 missense probably benign 0.05
R2133:Eps15l1 UTSW 8 72386868 missense probably benign 0.05
R3693:Eps15l1 UTSW 8 72399060 splice site probably benign
R4072:Eps15l1 UTSW 8 72380284 missense probably damaging 1.00
R4074:Eps15l1 UTSW 8 72380284 missense probably damaging 1.00
R4076:Eps15l1 UTSW 8 72380284 missense probably damaging 1.00
R4485:Eps15l1 UTSW 8 72399687 missense possibly damaging 0.78
R4592:Eps15l1 UTSW 8 72341394 missense probably damaging 0.96
R4606:Eps15l1 UTSW 8 72373916 missense possibly damaging 0.69
R4981:Eps15l1 UTSW 8 72378989 critical splice donor site probably null
R5496:Eps15l1 UTSW 8 72382775 missense probably benign 0.00
R5502:Eps15l1 UTSW 8 72378992 intron probably null
R5682:Eps15l1 UTSW 8 72371748 nonsense probably null
R6326:Eps15l1 UTSW 8 72341434 nonsense probably null
R6384:Eps15l1 UTSW 8 72368710 critical splice donor site probably null
R7305:Eps15l1 UTSW 8 72373034 missense probably benign
R7500:Eps15l1 UTSW 8 72382790 missense probably damaging 1.00
Z1088:Eps15l1 UTSW 8 72386901 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCTATTGCTATGACATCACTGTCCCG -3'
(R):5'- TATCTGCTGCCAGCCAAGCATC -3'

Sequencing Primer
(F):5'- CATGGGTGGTGGGGAGTC -3'
(R):5'- AGCTCACCTTGACTGCCTG -3'
Posted On2013-08-06