Incidental Mutation 'R0034:Kif15'
ID64592
Institutional Source Beutler Lab
Gene Symbol Kif15
Ensembl Gene ENSMUSG00000036768
Gene Namekinesin family member 15
SynonymsHKLP2, Knsl7, N-10 kinesin
MMRRC Submission 038328-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R0034 (G1)
Quality Score140
Status Validated
Chromosome9
Chromosomal Location122951046-123018733 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 122999285 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 887 (N887I)
Ref Sequence ENSEMBL: ENSMUSP00000035490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040717] [ENSMUST00000214652]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040717
AA Change: N887I

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000035490
Gene: ENSMUSG00000036768
AA Change: N887I

DomainStartEndE-ValueType
KISc 24 371 2.86e-179 SMART
Pfam:Kinesin-relat_1 463 551 6.6e-26 PFAM
coiled coil region 579 643 N/A INTRINSIC
coiled coil region 706 1037 N/A INTRINSIC
coiled coil region 1065 1133 N/A INTRINSIC
Pfam:HMMR_C 1265 1387 3.5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214183
Predicted Effect probably benign
Transcript: ENSMUST00000214652
AA Change: N659I

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
Meta Mutation Damage Score 0.098 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik C A 19: 7,420,359 H90Q probably damaging Het
4930402H24Rik T C 2: 130,736,572 H664R probably damaging Het
9430038I01Rik C T 7: 137,387,592 R60Q probably benign Het
Angpt4 C T 2: 151,929,391 T209I probably benign Het
Ap3b1 T C 13: 94,479,885 probably benign Het
Aplp1 A C 7: 30,444,442 V56G probably damaging Het
Asns G A 6: 7,676,299 P419L probably damaging Het
Atxn7 A T 14: 14,100,846 H844L probably damaging Het
Cd14 A G 18: 36,726,235 Y56H probably benign Het
Cd300lb C T 11: 114,928,399 V135I probably damaging Het
Cep152 C T 2: 125,583,893 A851T probably benign Het
Cfap74 C T 4: 155,460,887 probably benign Het
Col28a1 T A 6: 8,175,708 I47L probably benign Het
Eef1d T C 15: 75,902,959 T200A probably benign Het
Faap100 A T 11: 120,372,147 M795K probably benign Het
Gabpb1 C T 2: 126,658,534 R15Q possibly damaging Het
Gata4 C A 14: 63,201,484 M381I probably benign Het
Gm5114 A G 7: 39,408,858 S446P possibly damaging Het
Gm7271 A G 5: 76,516,530 I155M probably damaging Het
Gnb1 T A 4: 155,551,689 N155K probably benign Het
Haspin G A 11: 73,138,218 T15M probably damaging Het
Heatr5a A G 12: 51,925,172 L745P probably damaging Het
Kcng3 T A 17: 83,588,383 probably benign Het
Kif26a T C 12: 112,168,963 probably benign Het
Kif9 G A 9: 110,519,611 C738Y probably benign Het
Kifc2 G T 15: 76,667,100 C613F probably benign Het
Klf12 A G 14: 99,987,429 probably null Het
Lrp1 A T 10: 127,545,651 I3826N probably benign Het
Map2k4 A G 11: 65,719,611 probably benign Het
Myo7b A G 18: 31,960,860 S2006P probably damaging Het
Olfr631 T C 7: 103,929,501 V226A probably benign Het
Pax4 T C 6: 28,442,449 T285A probably benign Het
Pcdhb5 A G 18: 37,322,084 N506D probably damaging Het
Pkhd1l1 G A 15: 44,504,009 G768S probably benign Het
Plb1 G T 5: 32,273,113 G138V probably benign Het
Poln A C 5: 34,115,418 V398G possibly damaging Het
Poteg A G 8: 27,462,077 probably benign Het
Rapgef1 C A 2: 29,724,768 probably benign Het
Rbm43 A T 2: 51,925,710 D166E probably benign Het
Rhobtb2 T C 14: 69,788,688 T602A probably benign Het
Samd3 G A 10: 26,271,500 probably benign Het
Sbno2 A C 10: 80,058,340 probably benign Het
Sec1 A G 7: 45,679,335 V96A probably benign Het
Senp7 A C 16: 56,153,570 S385R possibly damaging Het
Sgk3 T C 1: 9,885,677 V301A probably damaging Het
Sgpl1 A T 10: 61,102,613 M467K probably damaging Het
Slc22a26 A G 19: 7,802,253 I66T probably benign Het
Stra6 G A 9: 58,151,469 probably null Het
Tfrc T A 16: 32,615,396 probably null Het
Tmem30b T C 12: 73,546,005 Y112C probably damaging Het
Trap1 A T 16: 4,069,030 probably benign Het
Trpc1 A G 9: 95,749,761 S43P probably damaging Het
Tsku T C 7: 98,352,663 T154A possibly damaging Het
Uroc1 T C 6: 90,345,310 V272A probably damaging Het
Vmn1r69 T A 7: 10,580,811 probably benign Het
Vmn2r1 T A 3: 64,090,014 W364R probably damaging Het
Wnk2 G T 13: 49,068,080 T377K possibly damaging Het
Zscan20 T C 4: 128,585,662 N1012S probably damaging Het
Other mutations in Kif15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Kif15 APN 9 122975755 missense probably damaging 1.00
IGL01577:Kif15 APN 9 122996334 missense probably benign 0.06
IGL01647:Kif15 APN 9 122963471 intron probably benign
IGL01921:Kif15 APN 9 122979504 missense probably damaging 1.00
IGL02040:Kif15 APN 9 123017385 missense probably damaging 0.99
IGL02191:Kif15 APN 9 122975679 missense probably damaging 1.00
IGL02218:Kif15 APN 9 122995827 splice site probably benign
IGL02537:Kif15 APN 9 122993849 missense probably benign 0.08
IGL02814:Kif15 APN 9 123003640 missense possibly damaging 0.83
PIT4480001:Kif15 UTSW 9 123011543 missense probably benign
R0458:Kif15 UTSW 9 123009359 missense probably benign
R0526:Kif15 UTSW 9 122997797 missense probably damaging 0.96
R0533:Kif15 UTSW 9 123009433 unclassified probably benign
R0726:Kif15 UTSW 9 122959928 missense probably benign 0.21
R1580:Kif15 UTSW 9 122959956 missense probably benign 0.22
R1597:Kif15 UTSW 9 122994009 missense probably benign 0.22
R2096:Kif15 UTSW 9 122986187 missense probably damaging 1.00
R3125:Kif15 UTSW 9 122987961 missense probably damaging 0.99
R3176:Kif15 UTSW 9 122987840 splice site probably benign
R4088:Kif15 UTSW 9 122986189 missense probably benign 0.29
R4308:Kif15 UTSW 9 123013982 missense probably benign 0.00
R4597:Kif15 UTSW 9 122993849 missense probably benign 0.08
R4705:Kif15 UTSW 9 122959993 splice site probably null
R4832:Kif15 UTSW 9 123002126 splice site probably null
R5100:Kif15 UTSW 9 122991994 missense probably damaging 0.98
R5126:Kif15 UTSW 9 122975758 missense probably damaging 1.00
R5180:Kif15 UTSW 9 122999210 missense probably damaging 0.99
R5247:Kif15 UTSW 9 122986442 missense possibly damaging 0.65
R5376:Kif15 UTSW 9 122993971 missense probably benign 0.04
R5392:Kif15 UTSW 9 122996295 missense probably damaging 0.99
R5422:Kif15 UTSW 9 122984889 synonymous probably null
R5562:Kif15 UTSW 9 122978016 missense probably damaging 1.00
R5663:Kif15 UTSW 9 122991851 splice site probably null
R5767:Kif15 UTSW 9 123013974 missense possibly damaging 0.78
R5927:Kif15 UTSW 9 123017261 missense probably benign 0.00
R6049:Kif15 UTSW 9 123011622 missense probably damaging 0.98
R6435:Kif15 UTSW 9 122986491 missense probably damaging 1.00
R7040:Kif15 UTSW 9 123011614 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- AGCTCAGAGCTGAGGTTGTTGC -3'
(R):5'- GGTTGCTCCAGGAAATCAGAGAACG -3'

Sequencing Primer
(F):5'- GTGAGCTACATCACCAATTGTC -3'
(R):5'- CGGGACAGGAAGCAAAGAC -3'
Posted On2013-08-06