Incidental Mutation 'R0034:2700081O15Rik'
List |< first << previous [record 100 of 18487] next >> last >|
ID64610
Institutional Source Beutler Lab
Gene Symbol 2700081O15Rik
Ensembl Gene ENSMUSG00000053080
Gene NameRIKEN cDNA 2700081O15 gene
Synonyms
MMRRC Submission 038328-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock #R0034 (G1)
Quality Score134
Status Validated
Chromosome19
Chromosomal Location7417625-7425904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 7420359 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 90 (H90Q)
Ref Sequence ENSEMBL: ENSMUSP00000139847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159348] [ENSMUST00000161907]
Predicted Effect probably benign
Transcript: ENSMUST00000159346
SMART Domains Protein: ENSMUSP00000124442
Gene: ENSMUSG00000053080

DomainStartEndE-ValueType
coiled coil region 14 41 N/A INTRINSIC
low complexity region 42 67 N/A INTRINSIC
low complexity region 72 97 N/A INTRINSIC
low complexity region 178 215 N/A INTRINSIC
ZnF_C2H2 231 256 2.06e1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000159348
AA Change: H144Q
SMART Domains Protein: ENSMUSP00000123773
Gene: ENSMUSG00000053080
AA Change: H144Q

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 46 58 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
ZnF_C2H2 124 149 3.38e1 SMART
low complexity region 171 201 N/A INTRINSIC
low complexity region 205 230 N/A INTRINSIC
low complexity region 235 260 N/A INTRINSIC
ZnF_C2H2 283 308 1.06e2 SMART
low complexity region 382 419 N/A INTRINSIC
ZnF_C2H2 435 460 2.06e1 SMART
low complexity region 491 522 N/A INTRINSIC
low complexity region 540 547 N/A INTRINSIC
low complexity region 557 572 N/A INTRINSIC
ZnF_C2H2 600 625 2.54e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160561
SMART Domains Protein: ENSMUSP00000124645
Gene: ENSMUSG00000053080

DomainStartEndE-ValueType
ZnF_C2H2 10 35 1.06e2 SMART
low complexity region 109 146 N/A INTRINSIC
ZnF_C2H2 162 187 2.06e1 SMART
low complexity region 218 249 N/A INTRINSIC
low complexity region 267 274 N/A INTRINSIC
low complexity region 284 299 N/A INTRINSIC
ZnF_C2H2 327 352 2.54e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161907
AA Change: H90Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139847
Gene: ENSMUSG00000053080
AA Change: H90Q

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
low complexity region 45 54 N/A INTRINSIC
ZnF_C2H2 70 95 1.4e-1 SMART
coiled coil region 124 151 N/A INTRINSIC
low complexity region 173 180 N/A INTRINSIC
low complexity region 190 205 N/A INTRINSIC
ZnF_C2H2 233 258 1.1e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189779
Predicted Effect probably benign
Transcript: ENSMUST00000191580
Meta Mutation Damage Score 0.23 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik T C 2: 130,736,572 H664R probably damaging Het
9430038I01Rik C T 7: 137,387,592 R60Q probably benign Het
Angpt4 C T 2: 151,929,391 T209I probably benign Het
Ap3b1 T C 13: 94,479,885 probably benign Het
Aplp1 A C 7: 30,444,442 V56G probably damaging Het
Asns G A 6: 7,676,299 P419L probably damaging Het
Atxn7 A T 14: 14,100,846 H844L probably damaging Het
Cd14 A G 18: 36,726,235 Y56H probably benign Het
Cd300lb C T 11: 114,928,399 V135I probably damaging Het
Cep152 C T 2: 125,583,893 A851T probably benign Het
Cfap74 C T 4: 155,460,887 probably benign Het
Col28a1 T A 6: 8,175,708 I47L probably benign Het
Eef1d T C 15: 75,902,959 T200A probably benign Het
Faap100 A T 11: 120,372,147 M795K probably benign Het
Gabpb1 C T 2: 126,658,534 R15Q possibly damaging Het
Gata4 C A 14: 63,201,484 M381I probably benign Het
Gm5114 A G 7: 39,408,858 S446P possibly damaging Het
Gm7271 A G 5: 76,516,530 I155M probably damaging Het
Gnb1 T A 4: 155,551,689 N155K probably benign Het
Haspin G A 11: 73,138,218 T15M probably damaging Het
Heatr5a A G 12: 51,925,172 L745P probably damaging Het
Kcng3 T A 17: 83,588,383 probably benign Het
Kif15 A T 9: 122,999,285 N887I possibly damaging Het
Kif26a T C 12: 112,168,963 probably benign Het
Kif9 G A 9: 110,519,611 C738Y probably benign Het
Kifc2 G T 15: 76,667,100 C613F probably benign Het
Klf12 A G 14: 99,987,429 probably null Het
Lrp1 A T 10: 127,545,651 I3826N probably benign Het
Map2k4 A G 11: 65,719,611 probably benign Het
Myo7b A G 18: 31,960,860 S2006P probably damaging Het
Olfr631 T C 7: 103,929,501 V226A probably benign Het
Pax4 T C 6: 28,442,449 T285A probably benign Het
Pcdhb5 A G 18: 37,322,084 N506D probably damaging Het
Pkhd1l1 G A 15: 44,504,009 G768S probably benign Het
Plb1 G T 5: 32,273,113 G138V probably benign Het
Poln A C 5: 34,115,418 V398G possibly damaging Het
Poteg A G 8: 27,462,077 probably benign Het
Rapgef1 C A 2: 29,724,768 probably benign Het
Rbm43 A T 2: 51,925,710 D166E probably benign Het
Rhobtb2 T C 14: 69,788,688 T602A probably benign Het
Samd3 G A 10: 26,271,500 probably benign Het
Sbno2 A C 10: 80,058,340 probably benign Het
Sec1 A G 7: 45,679,335 V96A probably benign Het
Senp7 A C 16: 56,153,570 S385R possibly damaging Het
Sgk3 T C 1: 9,885,677 V301A probably damaging Het
Sgpl1 A T 10: 61,102,613 M467K probably damaging Het
Slc22a26 A G 19: 7,802,253 I66T probably benign Het
Stra6 G A 9: 58,151,469 probably null Het
Tfrc T A 16: 32,615,396 probably null Het
Tmem30b T C 12: 73,546,005 Y112C probably damaging Het
Trap1 A T 16: 4,069,030 probably benign Het
Trpc1 A G 9: 95,749,761 S43P probably damaging Het
Tsku T C 7: 98,352,663 T154A possibly damaging Het
Uroc1 T C 6: 90,345,310 V272A probably damaging Het
Vmn1r69 T A 7: 10,580,811 probably benign Het
Vmn2r1 T A 3: 64,090,014 W364R probably damaging Het
Wnk2 G T 13: 49,068,080 T377K possibly damaging Het
Zscan20 T C 4: 128,585,662 N1012S probably damaging Het
Other mutations in 2700081O15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02376:2700081O15Rik APN 19 7422376 missense probably damaging 1.00
IGL02814:2700081O15Rik APN 19 7420422 missense possibly damaging 0.94
H8562:2700081O15Rik UTSW 19 7422921 missense probably benign 0.01
R0583:2700081O15Rik UTSW 19 7420274 missense probably damaging 1.00
R2351:2700081O15Rik UTSW 19 7422244 missense probably damaging 1.00
R4326:2700081O15Rik UTSW 19 7421226 intron probably benign
R4329:2700081O15Rik UTSW 19 7421226 intron probably benign
R5474:2700081O15Rik UTSW 19 7420159 missense probably damaging 1.00
R5735:2700081O15Rik UTSW 19 7422796 missense probably benign
R6168:2700081O15Rik UTSW 19 7422940 missense probably benign 0.40
R6739:2700081O15Rik UTSW 19 7421347 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCAGCATCTTCAGGCAGGAAATAC -3'
(R):5'- TGGGCTTCTTTGTGCCAACACC -3'

Sequencing Primer
(F):5'- ACTCAGATCATTGTGAGGCTC -3'
(R):5'- GCTGTTGCTGATCACTTCCT -3'
Posted On2013-08-06