Incidental Mutation 'R0041:Rpl7a'
ID64696
Institutional Source Beutler Lab
Gene Symbol Rpl7a
Ensembl Gene ENSMUSG00000062647
Gene Nameribosomal protein L7A
Synonymssurfeit 3, Surf-3
MMRRC Submission 038335-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R0041 (G1)
Quality Score86
Status Validated
Chromosome2
Chromosomal Location26910764-26913318 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 26911551 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000015017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015017] [ENSMUST00000015920] [ENSMUST00000015934] [ENSMUST00000102898] [ENSMUST00000102899] [ENSMUST00000129682] [ENSMUST00000133513] [ENSMUST00000139815] [ENSMUST00000147110] [ENSMUST00000167661]
Predicted Effect probably null
Transcript: ENSMUST00000015017
SMART Domains Protein: ENSMUSP00000015017
Gene: ENSMUSG00000014873

DomainStartEndE-ValueType
Pfam:SURF2 4 251 5.7e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000015920
SMART Domains Protein: ENSMUSP00000015920
Gene: ENSMUSG00000015776

DomainStartEndE-ValueType
Pfam:Med22 20 125 5.7e-40 PFAM
low complexity region 127 141 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000015934
SMART Domains Protein: ENSMUSP00000015934
Gene: ENSMUSG00000015790

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
Pfam:SURF1 106 321 6.7e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083361
Predicted Effect probably benign
Transcript: ENSMUST00000102898
AA Change: Q85R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000099962
Gene: ENSMUSG00000062647
AA Change: Q85R

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
Pfam:Ribosomal_L7Ae 122 216 1.2e-25 PFAM
low complexity region 251 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102899
SMART Domains Protein: ENSMUSP00000099963
Gene: ENSMUSG00000015776

DomainStartEndE-ValueType
Pfam:Med22 14 130 5.6e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129673
Predicted Effect probably benign
Transcript: ENSMUST00000129682
Predicted Effect probably benign
Transcript: ENSMUST00000129822
Predicted Effect probably benign
Transcript: ENSMUST00000133513
SMART Domains Protein: ENSMUSP00000141317
Gene: ENSMUSG00000015790

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
Pfam:SURF1 30 63 7.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137376
Predicted Effect probably benign
Transcript: ENSMUST00000139815
SMART Domains Protein: ENSMUSP00000116442
Gene: ENSMUSG00000015776

DomainStartEndE-ValueType
Pfam:Med22 14 72 3e-14 PFAM
Pfam:Med22 96 166 2.7e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143678
Predicted Effect probably benign
Transcript: ENSMUST00000147110
SMART Domains Protein: ENSMUSP00000141238
Gene: ENSMUSG00000015790

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
Pfam:SURF1 30 240 5.1e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150776
Predicted Effect probably benign
Transcript: ENSMUST00000167661
SMART Domains Protein: ENSMUSP00000128488
Gene: ENSMUSG00000015790

DomainStartEndE-ValueType
low complexity region 51 66 N/A INTRINSIC
Pfam:SURF1 73 290 5.9e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183520
Meta Mutation Damage Score 0.208 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytoplasmic ribosomes, organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L7AE family of ribosomal proteins. It can interact with a subclass of nuclear hormone receptors, including thyroid hormone receptor, and inhibit their ability to transactivate by preventing their binding to their DNA response elements. This gene is included in the surfeit gene cluster, a group of very tightly linked genes that do not share sequence similarity. It is co-transcribed with the U24, U36a, U36b, and U36c small nucleolar RNA genes, which are located in its second, fifth, fourth, and sixth introns, respectively. This gene rearranges with the trk proto-oncogene to form the chimeric oncogene trk-2h, which encodes an oncoprotein consisting of the N terminus of ribosomal protein L7a fused to the receptor tyrosine kinase domain of trk. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,926,108 L110* probably null Het
Adamts13 A G 2: 26,983,974 R412G probably damaging Het
Adamts3 T A 5: 89,684,467 N927Y probably benign Het
Adgra3 A G 5: 49,960,559 Y1216H probably benign Het
Agpat3 C A 10: 78,288,047 probably benign Het
AI182371 T A 2: 35,085,721 Q277L possibly damaging Het
Arhgef15 A T 11: 68,954,516 L170Q possibly damaging Het
Avpi1 C A 19: 42,123,784 E112* probably null Het
Braf C T 6: 39,640,479 A534T probably damaging Het
Bspry G C 4: 62,486,554 A196P probably damaging Het
Cacna1c T A 6: 118,594,027 L2095F probably damaging Het
Cdhr2 A T 13: 54,726,838 S908C probably damaging Het
Cntnap5c C A 17: 57,876,469 Q57K probably benign Het
Dtna C T 18: 23,646,875 probably benign Het
Dynap A G 18: 70,242,034 S37P possibly damaging Het
Efna5 A T 17: 62,607,472 probably benign Het
Fancm T A 12: 65,106,443 C1224* probably null Het
Fbxw16 T A 9: 109,448,164 S37C probably damaging Het
Galnt4 A G 10: 99,108,512 Y33C probably benign Het
Kcnk2 G T 1: 189,295,691 N122K probably benign Het
Krt71 C A 15: 101,739,318 E222D probably damaging Het
Ltf T A 9: 111,029,568 D461E possibly damaging Het
Mapk4 A T 18: 73,935,038 L274Q probably damaging Het
Mbd6 A G 10: 127,286,872 C103R probably damaging Het
Nbeal1 A G 1: 60,281,871 N2047S probably benign Het
Nefh C T 11: 4,945,184 S335N possibly damaging Het
Obscn G T 11: 59,043,977 H4715N probably damaging Het
Olfml1 A T 7: 107,590,186 I153L possibly damaging Het
Olfr213 G A 6: 116,541,334 V294I possibly damaging Het
Olfr954 T A 9: 39,461,476 F12Y probably benign Het
Pck1 A G 2: 173,155,210 E215G probably benign Het
Peg12 T A 7: 62,463,560 E263V unknown Het
Phkg1 T A 5: 129,874,262 T15S probably benign Het
Plekhg1 T A 10: 3,964,076 L1120* probably null Het
Rlf T A 4: 121,149,929 H618L probably damaging Het
Rnf112 T A 11: 61,452,355 R165W probably damaging Het
Rnf213 A G 11: 119,402,575 T51A probably benign Het
Rnf220 A G 4: 117,273,284 L293P probably damaging Het
Rock1 T C 18: 10,140,240 D117G probably damaging Het
Rp1 A G 1: 4,344,628 V2087A probably benign Het
Serpinb6d A G 13: 33,667,632 D124G probably damaging Het
Skor1 T G 9: 63,145,851 T279P probably damaging Het
Son A T 16: 91,659,333 E1656V probably damaging Het
Swap70 A G 7: 110,279,355 K511E probably benign Het
Treh T C 9: 44,683,613 V262A probably benign Het
Trpm4 A G 7: 45,304,946 probably null Het
Ugt8a T C 3: 125,915,090 I124V probably benign Het
Wdr53 T C 16: 32,256,655 V226A probably damaging Het
Wdr64 G A 1: 175,726,471 W189* probably null Het
Other mutations in Rpl7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Rpl7a APN 2 26911055 unclassified probably benign
IGL00951:Rpl7a APN 2 26912429 missense possibly damaging 0.47
R1491:Rpl7a UTSW 2 26911115 missense probably damaging 0.98
R2102:Rpl7a UTSW 2 26911461 missense possibly damaging 0.93
R6601:Rpl7a UTSW 2 26911524 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- CCTTGACGGGCAATGGACTGAATG -3'
(R):5'- ATTGTGGTACACTGATGAGACGGC -3'

Sequencing Primer
(F):5'- AAGATCGCTGATGCACCG -3'
(R):5'- CGGCAGGAGGTCAACAC -3'
Posted On2013-08-06