Incidental Mutation 'R0041:Rlf'
ID64702
Institutional Source Beutler Lab
Gene Symbol Rlf
Ensembl Gene ENSMUSG00000049878
Gene Namerearranged L-myc fusion sequence
SynonymsMommeD8, 9230110M18Rik
MMRRC Submission 038335-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0041 (G1)
Quality Score92
Status Validated
Chromosome4
Chromosomal Location121145373-121215084 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121149929 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 618 (H618L)
Ref Sequence ENSEMBL: ENSMUSP00000127068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056635] [ENSMUST00000168615]
Predicted Effect probably damaging
Transcript: ENSMUST00000056635
AA Change: H728L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050825
Gene: ENSMUSG00000049878
AA Change: H728L

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
low complexity region 129 149 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
ZnF_C2H2 554 575 1.27e2 SMART
ZnF_C2H2 581 603 1.08e-1 SMART
ZnF_C2H2 667 692 5.42e-2 SMART
ZnF_C2H2 710 732 8.09e-1 SMART
ZnF_C2H2 738 762 3.99e0 SMART
ZnF_C2H2 767 791 3.16e-3 SMART
ZnF_C2H2 797 821 1.18e-2 SMART
low complexity region 885 909 N/A INTRINSIC
ZnF_C2H2 949 974 2.57e-3 SMART
low complexity region 1055 1066 N/A INTRINSIC
ZnF_C2H2 1122 1147 5.9e-3 SMART
ZnF_C2H2 1167 1190 4.17e-3 SMART
low complexity region 1259 1285 N/A INTRINSIC
ZnF_C2H2 1303 1328 5.06e-2 SMART
ZnF_C2H2 1355 1380 6.57e-1 SMART
ZnF_C2H2 1400 1425 3.83e-2 SMART
ZnF_C2H2 1437 1462 8.81e-2 SMART
low complexity region 1488 1514 N/A INTRINSIC
low complexity region 1521 1533 N/A INTRINSIC
ZnF_C2H2 1556 1581 4.81e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168615
AA Change: H618L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127068
Gene: ENSMUSG00000049878
AA Change: H618L

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 444 465 1.27e2 SMART
ZnF_C2H2 471 493 1.08e-1 SMART
ZnF_C2H2 557 582 5.42e-2 SMART
ZnF_C2H2 600 622 8.09e-1 SMART
ZnF_C2H2 628 652 3.99e0 SMART
ZnF_C2H2 657 681 3.16e-3 SMART
ZnF_C2H2 687 711 1.18e-2 SMART
low complexity region 775 799 N/A INTRINSIC
ZnF_C2H2 839 864 2.57e-3 SMART
low complexity region 945 956 N/A INTRINSIC
ZnF_C2H2 1012 1037 5.9e-3 SMART
ZnF_C2H2 1057 1080 4.17e-3 SMART
low complexity region 1149 1175 N/A INTRINSIC
ZnF_C2H2 1193 1218 5.06e-2 SMART
ZnF_C2H2 1245 1270 6.57e-1 SMART
ZnF_C2H2 1290 1315 3.83e-2 SMART
ZnF_C2H2 1327 1352 8.81e-2 SMART
low complexity region 1378 1404 N/A INTRINSIC
low complexity region 1411 1423 N/A INTRINSIC
ZnF_C2H2 1446 1471 4.81e0 SMART
Meta Mutation Damage Score 0.408 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 97% (58/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a hypomorphic ENU-induced allele exhibit postnatal lethality. Only a few mice survive to weaning age exhibiting a decreased body size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,926,108 L110* probably null Het
Adamts13 A G 2: 26,983,974 R412G probably damaging Het
Adamts3 T A 5: 89,684,467 N927Y probably benign Het
Adgra3 A G 5: 49,960,559 Y1216H probably benign Het
Agpat3 C A 10: 78,288,047 probably benign Het
AI182371 T A 2: 35,085,721 Q277L possibly damaging Het
Arhgef15 A T 11: 68,954,516 L170Q possibly damaging Het
Avpi1 C A 19: 42,123,784 E112* probably null Het
Braf C T 6: 39,640,479 A534T probably damaging Het
Bspry G C 4: 62,486,554 A196P probably damaging Het
Cacna1c T A 6: 118,594,027 L2095F probably damaging Het
Cdhr2 A T 13: 54,726,838 S908C probably damaging Het
Cntnap5c C A 17: 57,876,469 Q57K probably benign Het
Dtna C T 18: 23,646,875 probably benign Het
Dynap A G 18: 70,242,034 S37P possibly damaging Het
Efna5 A T 17: 62,607,472 probably benign Het
Fancm T A 12: 65,106,443 C1224* probably null Het
Fbxw16 T A 9: 109,448,164 S37C probably damaging Het
Galnt4 A G 10: 99,108,512 Y33C probably benign Het
Kcnk2 G T 1: 189,295,691 N122K probably benign Het
Krt71 C A 15: 101,739,318 E222D probably damaging Het
Ltf T A 9: 111,029,568 D461E possibly damaging Het
Mapk4 A T 18: 73,935,038 L274Q probably damaging Het
Mbd6 A G 10: 127,286,872 C103R probably damaging Het
Nbeal1 A G 1: 60,281,871 N2047S probably benign Het
Nefh C T 11: 4,945,184 S335N possibly damaging Het
Obscn G T 11: 59,043,977 H4715N probably damaging Het
Olfml1 A T 7: 107,590,186 I153L possibly damaging Het
Olfr213 G A 6: 116,541,334 V294I possibly damaging Het
Olfr954 T A 9: 39,461,476 F12Y probably benign Het
Pck1 A G 2: 173,155,210 E215G probably benign Het
Peg12 T A 7: 62,463,560 E263V unknown Het
Phkg1 T A 5: 129,874,262 T15S probably benign Het
Plekhg1 T A 10: 3,964,076 L1120* probably null Het
Rnf112 T A 11: 61,452,355 R165W probably damaging Het
Rnf213 A G 11: 119,402,575 T51A probably benign Het
Rnf220 A G 4: 117,273,284 L293P probably damaging Het
Rock1 T C 18: 10,140,240 D117G probably damaging Het
Rp1 A G 1: 4,344,628 V2087A probably benign Het
Rpl7a A G 2: 26,911,551 probably null Het
Serpinb6d A G 13: 33,667,632 D124G probably damaging Het
Skor1 T G 9: 63,145,851 T279P probably damaging Het
Son A T 16: 91,659,333 E1656V probably damaging Het
Swap70 A G 7: 110,279,355 K511E probably benign Het
Treh T C 9: 44,683,613 V262A probably benign Het
Trpm4 A G 7: 45,304,946 probably null Het
Ugt8a T C 3: 125,915,090 I124V probably benign Het
Wdr53 T C 16: 32,256,655 V226A probably damaging Het
Wdr64 G A 1: 175,726,471 W189* probably null Het
Other mutations in Rlf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Rlf APN 4 121170686 missense possibly damaging 0.89
IGL00558:Rlf APN 4 121150973 missense probably damaging 1.00
IGL00990:Rlf APN 4 121148339 missense possibly damaging 0.87
IGL01625:Rlf APN 4 121188260 missense possibly damaging 0.68
IGL01921:Rlf APN 4 121146746 missense probably damaging 1.00
IGL01986:Rlf APN 4 121148106 missense probably damaging 1.00
IGL02232:Rlf APN 4 121182614 missense probably benign 0.21
IGL02586:Rlf APN 4 121150064 missense probably damaging 1.00
IGL03177:Rlf APN 4 121148079 nonsense probably null
IGL03233:Rlf APN 4 121182600 splice site probably benign
IGL03293:Rlf APN 4 121148330 missense probably benign 0.18
Brady UTSW 4 121148553 nonsense probably null
bunch UTSW 4 121154975 missense probably damaging 1.00
transsubstantiation UTSW 4 121148291 missense probably benign 0.10
wafer UTSW 4 121150532 missense probably benign 0.00
wine UTSW 4 121148172 missense probably damaging 1.00
PIT4651001:Rlf UTSW 4 121150313 missense probably damaging 0.98
R0019:Rlf UTSW 4 121146572 missense possibly damaging 0.46
R0019:Rlf UTSW 4 121146572 missense possibly damaging 0.46
R0039:Rlf UTSW 4 121146842 missense possibly damaging 0.90
R0041:Rlf UTSW 4 121149929 missense probably damaging 1.00
R0590:Rlf UTSW 4 121170833 splice site probably benign
R1562:Rlf UTSW 4 121150391 missense possibly damaging 0.47
R1585:Rlf UTSW 4 121148291 missense probably benign 0.10
R1627:Rlf UTSW 4 121150000 missense probably benign 0.34
R1709:Rlf UTSW 4 121149823 missense probably benign 0.00
R1968:Rlf UTSW 4 121148420 missense probably damaging 1.00
R1982:Rlf UTSW 4 121150112 missense probably damaging 1.00
R3120:Rlf UTSW 4 121149483 missense probably benign 0.01
R3155:Rlf UTSW 4 121149332 missense probably damaging 1.00
R3162:Rlf UTSW 4 121148847 missense probably damaging 1.00
R3162:Rlf UTSW 4 121148847 missense probably damaging 1.00
R3429:Rlf UTSW 4 121150532 missense probably benign 0.00
R3430:Rlf UTSW 4 121150532 missense probably benign 0.00
R3700:Rlf UTSW 4 121150863 missense possibly damaging 0.77
R3732:Rlf UTSW 4 121148324 missense probably benign
R3909:Rlf UTSW 4 121149032 missense probably benign 0.00
R4033:Rlf UTSW 4 121147343 missense probably damaging 1.00
R4350:Rlf UTSW 4 121149096 missense probably benign 0.16
R4654:Rlf UTSW 4 121150601 missense probably benign 0.28
R4976:Rlf UTSW 4 121147455 missense probably damaging 0.98
R5060:Rlf UTSW 4 121146866 missense probably benign 0.00
R5105:Rlf UTSW 4 121150367 missense probably damaging 1.00
R5119:Rlf UTSW 4 121147455 missense probably damaging 0.98
R5150:Rlf UTSW 4 121148172 missense probably damaging 1.00
R5198:Rlf UTSW 4 121148553 nonsense probably null
R5214:Rlf UTSW 4 121150700 missense probably damaging 1.00
R6084:Rlf UTSW 4 121149215 missense possibly damaging 0.95
R6131:Rlf UTSW 4 121154975 missense probably damaging 1.00
R6188:Rlf UTSW 4 121170766 missense probably damaging 1.00
R6313:Rlf UTSW 4 121148610 missense probably damaging 0.99
R6332:Rlf UTSW 4 121148822 missense possibly damaging 0.75
R6341:Rlf UTSW 4 121149360 nonsense probably null
R6413:Rlf UTSW 4 121147325 missense probably damaging 1.00
R6683:Rlf UTSW 4 121147926 missense probably damaging 1.00
R7066:Rlf UTSW 4 121148787 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGTAAAGCTGGCCCAAGTCAC -3'
(R):5'- TTAGCAAGTTAGAAGACCGCCGC -3'

Sequencing Primer
(F):5'- TGGCCCAAGTCACTGAAC -3'
(R):5'- ACAGAGACTTGTACCCGTGTC -3'
Posted On2013-08-06