Incidental Mutation 'R0041:Braf'
ID64704
Institutional Source Beutler Lab
Gene Symbol Braf
Ensembl Gene ENSMUSG00000002413
Gene NameBraf transforming gene
SynonymsBraf-2, D6Ertd631e, 9930012E13Rik, Braf2
MMRRC Submission 038335-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0041 (G1)
Quality Score149
Status Validated
Chromosome6
Chromosomal Location39603237-39725463 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 39640479 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 534 (A534T)
Ref Sequence ENSEMBL: ENSMUSP00000002487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002487] [ENSMUST00000101497]
Predicted Effect probably damaging
Transcript: ENSMUST00000002487
AA Change: A534T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002487
Gene: ENSMUSG00000002413
AA Change: A534T

DomainStartEndE-ValueType
low complexity region 5 30 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
coiled coil region 94 121 N/A INTRINSIC
RBD 139 211 1.04e-33 SMART
C1 219 264 1.05e-13 SMART
low complexity region 297 311 N/A INTRINSIC
low complexity region 316 326 N/A INTRINSIC
low complexity region 459 474 N/A INTRINSIC
Pfam:Pkinase_Tyr 494 751 9.6e-65 PFAM
Pfam:Pkinase 494 753 5.1e-60 PFAM
Pfam:Kinase-like 573 741 3e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101497
AA Change: A481T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099036
Gene: ENSMUSG00000002413
AA Change: A481T

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
coiled coil region 60 88 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
RBD 138 210 1.04e-33 SMART
C1 218 263 1.05e-13 SMART
low complexity region 296 310 N/A INTRINSIC
low complexity region 315 325 N/A INTRINSIC
low complexity region 406 421 N/A INTRINSIC
Pfam:Pkinase 441 698 8.2e-62 PFAM
Pfam:Pkinase_Tyr 441 698 1.5e-65 PFAM
Pfam:Kinase-like 523 688 3.2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167169
Meta Mutation Damage Score 0.296 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the raf/mil family of serine/threonine protein kinases. This protein plays a role in regulating the MAP kinase/ERKs signaling pathway, which affects cell division, differentiation, and secretion. Mutations in this gene are associated with cardiofaciocutaneous syndrome, a disease characterized by heart defects, mental retardation and a distinctive facial appearance. Mutations in this gene have also been associated with various cancers, including non-Hodgkin lymphoma, colorectal cancer, malignant melanoma, thyroid carcinoma, non-small cell lung carcinoma, and adenocarcinoma of lung. A pseudogene, which is located on chromosome X, has been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die during organogenesis, are smaller, have enlarged blood vessels, hemorrhaging, poor circulation, slow heartbeat and abnormal endothelial cell development. Mice homozygous for a targeted allele activated in neurons exhibit impaired neuronal differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,926,108 L110* probably null Het
Adamts13 A G 2: 26,983,974 R412G probably damaging Het
Adamts3 T A 5: 89,684,467 N927Y probably benign Het
Adgra3 A G 5: 49,960,559 Y1216H probably benign Het
Agpat3 C A 10: 78,288,047 probably benign Het
AI182371 T A 2: 35,085,721 Q277L possibly damaging Het
Arhgef15 A T 11: 68,954,516 L170Q possibly damaging Het
Avpi1 C A 19: 42,123,784 E112* probably null Het
Bspry G C 4: 62,486,554 A196P probably damaging Het
Cacna1c T A 6: 118,594,027 L2095F probably damaging Het
Cdhr2 A T 13: 54,726,838 S908C probably damaging Het
Cntnap5c C A 17: 57,876,469 Q57K probably benign Het
Dtna C T 18: 23,646,875 probably benign Het
Dynap A G 18: 70,242,034 S37P possibly damaging Het
Efna5 A T 17: 62,607,472 probably benign Het
Fancm T A 12: 65,106,443 C1224* probably null Het
Fbxw16 T A 9: 109,448,164 S37C probably damaging Het
Galnt4 A G 10: 99,108,512 Y33C probably benign Het
Kcnk2 G T 1: 189,295,691 N122K probably benign Het
Krt71 C A 15: 101,739,318 E222D probably damaging Het
Ltf T A 9: 111,029,568 D461E possibly damaging Het
Mapk4 A T 18: 73,935,038 L274Q probably damaging Het
Mbd6 A G 10: 127,286,872 C103R probably damaging Het
Nbeal1 A G 1: 60,281,871 N2047S probably benign Het
Nefh C T 11: 4,945,184 S335N possibly damaging Het
Obscn G T 11: 59,043,977 H4715N probably damaging Het
Olfml1 A T 7: 107,590,186 I153L possibly damaging Het
Olfr213 G A 6: 116,541,334 V294I possibly damaging Het
Olfr954 T A 9: 39,461,476 F12Y probably benign Het
Pck1 A G 2: 173,155,210 E215G probably benign Het
Peg12 T A 7: 62,463,560 E263V unknown Het
Phkg1 T A 5: 129,874,262 T15S probably benign Het
Plekhg1 T A 10: 3,964,076 L1120* probably null Het
Rlf T A 4: 121,149,929 H618L probably damaging Het
Rnf112 T A 11: 61,452,355 R165W probably damaging Het
Rnf213 A G 11: 119,402,575 T51A probably benign Het
Rnf220 A G 4: 117,273,284 L293P probably damaging Het
Rock1 T C 18: 10,140,240 D117G probably damaging Het
Rp1 A G 1: 4,344,628 V2087A probably benign Het
Rpl7a A G 2: 26,911,551 probably null Het
Serpinb6d A G 13: 33,667,632 D124G probably damaging Het
Skor1 T G 9: 63,145,851 T279P probably damaging Het
Son A T 16: 91,659,333 E1656V probably damaging Het
Swap70 A G 7: 110,279,355 K511E probably benign Het
Treh T C 9: 44,683,613 V262A probably benign Het
Trpm4 A G 7: 45,304,946 probably null Het
Ugt8a T C 3: 125,915,090 I124V probably benign Het
Wdr53 T C 16: 32,256,655 V226A probably damaging Het
Wdr64 G A 1: 175,726,471 W189* probably null Het
Other mutations in Braf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Braf APN 6 39660999 splice site probably null
IGL01616:Braf APN 6 39651652 missense probably damaging 1.00
IGL01621:Braf APN 6 39646853 intron probably benign
IGL01825:Braf APN 6 39639590 missense probably damaging 0.99
IGL02435:Braf APN 6 39646766 missense probably benign 0.00
IGL02629:Braf APN 6 39688299 missense possibly damaging 0.83
IGL02751:Braf APN 6 39660867 splice site probably benign
IGL02829:Braf APN 6 39627728 missense possibly damaging 0.62
R0041:Braf UTSW 6 39640479 missense probably damaging 1.00
R0497:Braf UTSW 6 39640549 splice site probably benign
R0512:Braf UTSW 6 39664989 splice site probably benign
R0604:Braf UTSW 6 39623697 missense probably damaging 1.00
R0726:Braf UTSW 6 39662148 missense possibly damaging 0.90
R1468:Braf UTSW 6 39665083 missense probably damaging 1.00
R1468:Braf UTSW 6 39665083 missense probably damaging 1.00
R1616:Braf UTSW 6 39643133 missense probably benign 0.35
R2160:Braf UTSW 6 39662073 missense probably damaging 1.00
R3722:Braf UTSW 6 39623676 missense probably damaging 1.00
R4407:Braf UTSW 6 39615720 missense probably damaging 1.00
R4540:Braf UTSW 6 39644333 missense probably damaging 1.00
R5026:Braf UTSW 6 39688287 missense probably benign 0.22
R5478:Braf UTSW 6 39677574 missense possibly damaging 0.94
R6284:Braf UTSW 6 39688282 missense possibly damaging 0.73
R6993:Braf UTSW 6 39643163 missense probably damaging 1.00
R7251:Braf UTSW 6 39677570 critical splice donor site probably null
Z1088:Braf UTSW 6 39662026 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACGTAAACCCATTTTCCTCTAACCAC -3'
(R):5'- CGAGCACTCACTGACCAGGTAAC -3'

Sequencing Primer
(F):5'- actctctctcatttgtcaatgttc -3'
(R):5'- ACCTAAGTGTATTCCCAGGGTG -3'
Posted On2013-08-06