Incidental Mutation 'R0041:Rnf112'
ID64710
Institutional Source Beutler Lab
Gene Symbol Rnf112
Ensembl Gene ENSMUSG00000010086
Gene Namering finger protein 112
SynonymsZfp179, bfp
MMRRC Submission 038335-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R0041 (G1)
Quality Score157
Status Validated
Chromosome11
Chromosomal Location61448442-61454131 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61452355 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 165 (R165W)
Ref Sequence ENSEMBL: ENSMUSP00000099722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054927] [ENSMUST00000060255] [ENSMUST00000102661]
Predicted Effect probably damaging
Transcript: ENSMUST00000054927
AA Change: R188W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056464
Gene: ENSMUSG00000010086
AA Change: R188W

DomainStartEndE-ValueType
RING 80 120 3.78e-5 SMART
low complexity region 139 150 N/A INTRINSIC
Pfam:GBP 171 423 1.3e-21 PFAM
low complexity region 541 557 N/A INTRINSIC
transmembrane domain 570 592 N/A INTRINSIC
transmembrane domain 605 627 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000060255
AA Change: R188W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059903
Gene: ENSMUSG00000010086
AA Change: R188W

DomainStartEndE-ValueType
RING 80 120 3.78e-5 SMART
low complexity region 139 150 N/A INTRINSIC
Pfam:GBP 171 448 2.8e-21 PFAM
low complexity region 566 582 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
transmembrane domain 630 652 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102661
AA Change: R165W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099722
Gene: ENSMUSG00000010086
AA Change: R165W

DomainStartEndE-ValueType
RING 57 97 1.7e-7 SMART
low complexity region 116 127 N/A INTRINSIC
Pfam:GBP 148 400 2.7e-19 PFAM
low complexity region 518 534 N/A INTRINSIC
transmembrane domain 547 569 N/A INTRINSIC
transmembrane domain 582 604 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136966
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152137
Meta Mutation Damage Score 0.424 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RING finger protein family of transcription factors. The protein is primarily expressed in brain. The gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced dendritic spines, functional synapses and paired pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,926,108 L110* probably null Het
Adamts13 A G 2: 26,983,974 R412G probably damaging Het
Adamts3 T A 5: 89,684,467 N927Y probably benign Het
Adgra3 A G 5: 49,960,559 Y1216H probably benign Het
Agpat3 C A 10: 78,288,047 probably benign Het
AI182371 T A 2: 35,085,721 Q277L possibly damaging Het
Arhgef15 A T 11: 68,954,516 L170Q possibly damaging Het
Avpi1 C A 19: 42,123,784 E112* probably null Het
Braf C T 6: 39,640,479 A534T probably damaging Het
Bspry G C 4: 62,486,554 A196P probably damaging Het
Cacna1c T A 6: 118,594,027 L2095F probably damaging Het
Cdhr2 A T 13: 54,726,838 S908C probably damaging Het
Cntnap5c C A 17: 57,876,469 Q57K probably benign Het
Dtna C T 18: 23,646,875 probably benign Het
Dynap A G 18: 70,242,034 S37P possibly damaging Het
Efna5 A T 17: 62,607,472 probably benign Het
Fancm T A 12: 65,106,443 C1224* probably null Het
Fbxw16 T A 9: 109,448,164 S37C probably damaging Het
Galnt4 A G 10: 99,108,512 Y33C probably benign Het
Kcnk2 G T 1: 189,295,691 N122K probably benign Het
Krt71 C A 15: 101,739,318 E222D probably damaging Het
Ltf T A 9: 111,029,568 D461E possibly damaging Het
Mapk4 A T 18: 73,935,038 L274Q probably damaging Het
Mbd6 A G 10: 127,286,872 C103R probably damaging Het
Nbeal1 A G 1: 60,281,871 N2047S probably benign Het
Nefh C T 11: 4,945,184 S335N possibly damaging Het
Obscn G T 11: 59,043,977 H4715N probably damaging Het
Olfml1 A T 7: 107,590,186 I153L possibly damaging Het
Olfr213 G A 6: 116,541,334 V294I possibly damaging Het
Olfr954 T A 9: 39,461,476 F12Y probably benign Het
Pck1 A G 2: 173,155,210 E215G probably benign Het
Peg12 T A 7: 62,463,560 E263V unknown Het
Phkg1 T A 5: 129,874,262 T15S probably benign Het
Plekhg1 T A 10: 3,964,076 L1120* probably null Het
Rlf T A 4: 121,149,929 H618L probably damaging Het
Rnf213 A G 11: 119,402,575 T51A probably benign Het
Rnf220 A G 4: 117,273,284 L293P probably damaging Het
Rock1 T C 18: 10,140,240 D117G probably damaging Het
Rp1 A G 1: 4,344,628 V2087A probably benign Het
Rpl7a A G 2: 26,911,551 probably null Het
Serpinb6d A G 13: 33,667,632 D124G probably damaging Het
Skor1 T G 9: 63,145,851 T279P probably damaging Het
Son A T 16: 91,659,333 E1656V probably damaging Het
Swap70 A G 7: 110,279,355 K511E probably benign Het
Treh T C 9: 44,683,613 V262A probably benign Het
Trpm4 A G 7: 45,304,946 probably null Het
Ugt8a T C 3: 125,915,090 I124V probably benign Het
Wdr53 T C 16: 32,256,655 V226A probably damaging Het
Wdr64 G A 1: 175,726,471 W189* probably null Het
Other mutations in Rnf112
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Rnf112 APN 11 61452784 missense probably damaging 1.00
IGL01339:Rnf112 APN 11 61450477 missense probably benign 0.00
IGL01469:Rnf112 APN 11 61451341 missense possibly damaging 0.94
IGL02102:Rnf112 APN 11 61452015 missense probably benign 0.36
IGL02216:Rnf112 APN 11 61449978 missense probably damaging 1.00
IGL02431:Rnf112 APN 11 61450379 missense probably benign 0.17
IGL02638:Rnf112 APN 11 61449405 utr 3 prime probably benign
IGL02657:Rnf112 APN 11 61450252 splice site probably null
R1514:Rnf112 UTSW 11 61450410 missense probably benign 0.01
R1991:Rnf112 UTSW 11 61452426 missense probably damaging 1.00
R2119:Rnf112 UTSW 11 61451028 missense possibly damaging 0.94
R2216:Rnf112 UTSW 11 61452279 missense probably damaging 1.00
R2880:Rnf112 UTSW 11 61450467 missense possibly damaging 0.89
R3775:Rnf112 UTSW 11 61450185 splice site probably benign
R3904:Rnf112 UTSW 11 61450385 missense probably damaging 1.00
R4646:Rnf112 UTSW 11 61452110 missense probably damaging 0.99
R4710:Rnf112 UTSW 11 61449831 missense probably damaging 1.00
R4860:Rnf112 UTSW 11 61452744 missense possibly damaging 0.67
R4860:Rnf112 UTSW 11 61452744 missense possibly damaging 0.67
R4894:Rnf112 UTSW 11 61452662 missense probably damaging 1.00
R4930:Rnf112 UTSW 11 61453465 missense probably benign
R4967:Rnf112 UTSW 11 61452926 splice site probably benign
R4992:Rnf112 UTSW 11 61452711 missense possibly damaging 0.72
R5547:Rnf112 UTSW 11 61451028 missense possibly damaging 0.94
R5874:Rnf112 UTSW 11 61449447 missense probably damaging 0.98
R5997:Rnf112 UTSW 11 61451022 missense possibly damaging 0.87
R6023:Rnf112 UTSW 11 61449729 missense probably damaging 1.00
R6906:Rnf112 UTSW 11 61450389 missense probably null 0.38
R7194:Rnf112 UTSW 11 61450857 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCGCTGTCACCAGATTCCTAAAG -3'
(R):5'- ATGCTGTCCTGAATGCCGGAAG -3'

Sequencing Primer
(F):5'- AAGGTATCAGGCGGTCCTTTTC -3'
(R):5'- TACTCTATACTGTCCAGCAGGGG -3'
Posted On2013-08-06