Incidental Mutation 'R0041:Krt71'
ID64714
Institutional Source Beutler Lab
Gene Symbol Krt71
Ensembl Gene ENSMUSG00000051879
Gene Namekeratin 71
SynonymsCu, mK6irs, Krt2-6g, mK6irs1, Ca, Cal4
MMRRC Submission 038335-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock #R0041 (G1)
Quality Score115
Status Validated
Chromosome15
Chromosomal Location101733949-101743109 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 101739318 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 222 (E222D)
Ref Sequence ENSEMBL: ENSMUSP00000023710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023710]
Predicted Effect probably damaging
Transcript: ENSMUST00000023710
AA Change: E222D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023710
Gene: ENSMUSG00000051879
AA Change: E222D

DomainStartEndE-ValueType
low complexity region 17 55 N/A INTRINSIC
Pfam:Keratin_2_head 59 127 1.6e-20 PFAM
Filament 130 443 1.19e-151 SMART
low complexity region 449 465 N/A INTRINSIC
Meta Mutation Damage Score 0.236 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. This gene encodes a protein that is expressed in the inner root sheath of hair follicles. The type II keratins are clustered in a region of chromosome 12q13.[provided by RefSeq, Jun 2009]
PHENOTYPE: Mutations in this gene result in waved hair and curly vibrissae. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,926,108 L110* probably null Het
Adamts13 A G 2: 26,983,974 R412G probably damaging Het
Adamts3 T A 5: 89,684,467 N927Y probably benign Het
Adgra3 A G 5: 49,960,559 Y1216H probably benign Het
Agpat3 C A 10: 78,288,047 probably benign Het
AI182371 T A 2: 35,085,721 Q277L possibly damaging Het
Arhgef15 A T 11: 68,954,516 L170Q possibly damaging Het
Avpi1 C A 19: 42,123,784 E112* probably null Het
Braf C T 6: 39,640,479 A534T probably damaging Het
Bspry G C 4: 62,486,554 A196P probably damaging Het
Cacna1c T A 6: 118,594,027 L2095F probably damaging Het
Cdhr2 A T 13: 54,726,838 S908C probably damaging Het
Cntnap5c C A 17: 57,876,469 Q57K probably benign Het
Dtna C T 18: 23,646,875 probably benign Het
Dynap A G 18: 70,242,034 S37P possibly damaging Het
Efna5 A T 17: 62,607,472 probably benign Het
Fancm T A 12: 65,106,443 C1224* probably null Het
Fbxw16 T A 9: 109,448,164 S37C probably damaging Het
Galnt4 A G 10: 99,108,512 Y33C probably benign Het
Kcnk2 G T 1: 189,295,691 N122K probably benign Het
Ltf T A 9: 111,029,568 D461E possibly damaging Het
Mapk4 A T 18: 73,935,038 L274Q probably damaging Het
Mbd6 A G 10: 127,286,872 C103R probably damaging Het
Nbeal1 A G 1: 60,281,871 N2047S probably benign Het
Nefh C T 11: 4,945,184 S335N possibly damaging Het
Obscn G T 11: 59,043,977 H4715N probably damaging Het
Olfml1 A T 7: 107,590,186 I153L possibly damaging Het
Olfr213 G A 6: 116,541,334 V294I possibly damaging Het
Olfr954 T A 9: 39,461,476 F12Y probably benign Het
Pck1 A G 2: 173,155,210 E215G probably benign Het
Peg12 T A 7: 62,463,560 E263V unknown Het
Phkg1 T A 5: 129,874,262 T15S probably benign Het
Plekhg1 T A 10: 3,964,076 L1120* probably null Het
Rlf T A 4: 121,149,929 H618L probably damaging Het
Rnf112 T A 11: 61,452,355 R165W probably damaging Het
Rnf213 A G 11: 119,402,575 T51A probably benign Het
Rnf220 A G 4: 117,273,284 L293P probably damaging Het
Rock1 T C 18: 10,140,240 D117G probably damaging Het
Rp1 A G 1: 4,344,628 V2087A probably benign Het
Rpl7a A G 2: 26,911,551 probably null Het
Serpinb6d A G 13: 33,667,632 D124G probably damaging Het
Skor1 T G 9: 63,145,851 T279P probably damaging Het
Son A T 16: 91,659,333 E1656V probably damaging Het
Swap70 A G 7: 110,279,355 K511E probably benign Het
Treh T C 9: 44,683,613 V262A probably benign Het
Trpm4 A G 7: 45,304,946 probably null Het
Ugt8a T C 3: 125,915,090 I124V probably benign Het
Wdr53 T C 16: 32,256,655 V226A probably damaging Het
Wdr64 G A 1: 175,726,471 W189* probably null Het
Other mutations in Krt71
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Krt71 APN 15 101736674 missense probably damaging 1.00
IGL03076:Krt71 APN 15 101734597 missense probably benign 0.00
IGL03390:Krt71 APN 15 101734552 missense possibly damaging 0.93
R0040:Krt71 UTSW 15 101738433 missense possibly damaging 0.90
R0040:Krt71 UTSW 15 101738433 missense possibly damaging 0.90
R0153:Krt71 UTSW 15 101734706 missense possibly damaging 0.65
R0376:Krt71 UTSW 15 101738070 missense probably damaging 1.00
R0932:Krt71 UTSW 15 101736760 missense probably benign 0.20
R1263:Krt71 UTSW 15 101735466 missense probably damaging 1.00
R1646:Krt71 UTSW 15 101738764 splice site probably null
R1796:Krt71 UTSW 15 101742880 missense possibly damaging 0.68
R1954:Krt71 UTSW 15 101735466 nonsense probably null
R3001:Krt71 UTSW 15 101740471 splice site probably benign
R3793:Krt71 UTSW 15 101742910 missense probably damaging 1.00
R4236:Krt71 UTSW 15 101734694 missense probably benign 0.09
R4751:Krt71 UTSW 15 101735466 missense probably damaging 1.00
R6445:Krt71 UTSW 15 101740340 missense probably benign 0.06
R7034:Krt71 UTSW 15 101738337 missense probably benign 0.41
R7036:Krt71 UTSW 15 101738337 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- ATGTGTGAAGAGAGCCCCTCGAAC -3'
(R):5'- AAGCAGCTTGCTTCCTGCATCC -3'

Sequencing Primer
(F):5'- CGAACTGGCTCTTCTCTGC -3'
(R):5'- TAGCTTTCCCAAAGGCCG -3'
Posted On2013-08-06