Incidental Mutation 'R0021:Saal1'
ID64764
Institutional Source Beutler Lab
Gene Symbol Saal1
Ensembl Gene ENSMUSG00000006763
Gene Nameserum amyloid A-like 1
Synonyms5031425D22Rik
MMRRC Submission 038316-MU
Accession Numbers

Genbank: NM_030233

Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R0021 (G1)
Quality Score139
Status Validated
Chromosome7
Chromosomal Location46686108-46710680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46692892 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 376 (S376T)
Ref Sequence ENSEMBL: ENSMUSP00000120658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143082]
Predicted Effect probably damaging
Transcript: ENSMUST00000143082
AA Change: S376T

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120658
Gene: ENSMUSG00000006763
AA Change: S376T

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
SCOP:d1gw5a_ 40 455 2e-5 SMART
low complexity region 456 465 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209780
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210791
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 97% (60/62)
Allele List at MGI

All alleles(6) : Gene trapped(6)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310016G11Rik A G 7: 44,677,196 noncoding transcript Het
5830411N06Rik G A 7: 140,296,397 R594H probably benign Het
Abcc5 T A 16: 20,378,661 K647* probably null Het
Aplp1 A G 7: 30,435,816 probably benign Het
Arhgef25 A G 10: 127,189,554 I43T probably benign Het
AU019823 A C 9: 50,610,425 D65E probably damaging Het
BC003965 A G 17: 25,184,983 E99G possibly damaging Het
Brinp3 T G 1: 146,901,451 S545R probably benign Het
Btnl1 A G 17: 34,379,494 E28G probably benign Het
C5ar2 A G 7: 16,237,676 F109L probably benign Het
D630045J12Rik G A 6: 38,183,967 Q1081* probably null Het
Dhx36 T C 3: 62,477,595 I699V possibly damaging Het
Dnah9 A G 11: 65,969,979 I2855T probably benign Het
Dock8 T C 19: 25,163,047 I1317T probably benign Het
Galnt11 A T 5: 25,248,857 D27V probably damaging Het
Gm5134 T A 10: 75,993,884 C335S probably damaging Het
Hdhd2 A T 18: 76,970,615 K227N probably damaging Het
Impg1 A T 9: 80,435,426 L36Q probably damaging Het
Krtcap3 A G 5: 31,252,959 H227R probably benign Het
Lrrc7 A G 3: 158,160,661 Y1148H probably damaging Het
Map2k4 A G 11: 65,712,284 I174T probably damaging Het
Mef2c C A 13: 83,656,240 L282M probably damaging Het
Nqo2 T C 13: 33,981,507 I129T probably benign Het
Pdgfrb T A 18: 61,064,926 probably benign Het
Phf7 C T 14: 31,238,486 probably benign Het
Plac8 T A 5: 100,556,568 T88S probably benign Het
Pou2f1 G A 1: 165,876,018 T654M probably damaging Het
Ptprk T A 10: 28,592,895 V1425E probably damaging Het
Serpini1 T C 3: 75,619,313 Y291H probably damaging Het
Siah2 T C 3: 58,676,292 H191R probably benign Het
Spaca6 T A 17: 17,838,236 Y39* probably null Het
Tbc1d10a T C 11: 4,213,680 C277R probably damaging Het
Trim45 A T 3: 100,925,420 D323V probably damaging Het
Trim55 A C 3: 19,644,702 M32L probably benign Het
Unc5b T C 10: 60,778,919 T200A probably benign Het
V1rd19 A T 7: 24,003,604 D165V probably damaging Het
Other mutations in Saal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02727:Saal1 APN 7 46689799 splice site probably null
IGL03301:Saal1 APN 7 46702520 splice site probably benign
G5030:Saal1 UTSW 7 46692783 missense probably damaging 1.00
R0765:Saal1 UTSW 7 46699647 missense possibly damaging 0.76
R1086:Saal1 UTSW 7 46689459 splice site probably benign
R1273:Saal1 UTSW 7 46692942 missense probably damaging 0.99
R1466:Saal1 UTSW 7 46702545 intron probably null
R1466:Saal1 UTSW 7 46702545 intron probably null
R1661:Saal1 UTSW 7 46692800 missense possibly damaging 0.93
R1695:Saal1 UTSW 7 46692916 missense probably damaging 0.97
R2018:Saal1 UTSW 7 46699489 missense possibly damaging 0.93
R2058:Saal1 UTSW 7 46699456 missense probably damaging 1.00
R2059:Saal1 UTSW 7 46699456 missense probably damaging 1.00
R2326:Saal1 UTSW 7 46692811 missense probably benign 0.02
R4182:Saal1 UTSW 7 46710652 unclassified probably benign
R4704:Saal1 UTSW 7 46699740 intron probably benign
R4831:Saal1 UTSW 7 46699647 missense probably benign 0.22
R5270:Saal1 UTSW 7 46701733 intron probably benign
R5471:Saal1 UTSW 7 46699648 missense probably benign 0.06
R5790:Saal1 UTSW 7 46701928 missense probably damaging 1.00
R6699:Saal1 UTSW 7 46692817 missense probably damaging 1.00
R6804:Saal1 UTSW 7 46699640 frame shift probably null
R6934:Saal1 UTSW 7 46702664 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACAAGGAGCCCTGTGTTTGCC -3'
(R):5'- CATAGTCAAGCCTTGCAGAGGAGC -3'

Sequencing Primer
(F):5'- GTTTCAAGTTCAGGACATCAGG -3'
(R):5'- agcactgagcaaaagcaac -3'
Posted On2013-08-06