Incidental Mutation 'R0021:AU019823'
ID64766
Institutional Source Beutler Lab
Gene Symbol AU019823
Ensembl Gene ENSMUSG00000059820
Gene Nameexpressed sequence AU019823
SynonymsLOC270156
MMRRC Submission 038316-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.538) question?
Stock #R0021 (G1)
Quality Score117
Status Validated
Chromosome9
Chromosomal Location50605240-50617464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 50610425 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 65 (D65E)
Ref Sequence ENSEMBL: ENSMUSP00000133259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000131351] [ENSMUST00000145139] [ENSMUST00000147671] [ENSMUST00000155435] [ENSMUST00000171462]
Predicted Effect probably damaging
Transcript: ENSMUST00000131351
AA Change: D65E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123319
Gene: ENSMUSG00000059820
AA Change: D65E

DomainStartEndE-ValueType
low complexity region 142 175 N/A INTRINSIC
low complexity region 198 216 N/A INTRINSIC
low complexity region 224 256 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000145139
AA Change: D65E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000147671
AA Change: D65E

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117265
Gene: ENSMUSG00000059820
AA Change: D65E

DomainStartEndE-ValueType
low complexity region 142 175 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000155435
AA Change: D65E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121198
Gene: ENSMUSG00000059820
AA Change: D65E

DomainStartEndE-ValueType
low complexity region 142 175 N/A INTRINSIC
low complexity region 198 214 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171462
AA Change: D65E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133259
Gene: ENSMUSG00000059820
AA Change: D65E

DomainStartEndE-ValueType
Pfam:NKAP 86 163 5.2e-26 PFAM
low complexity region 198 216 N/A INTRINSIC
low complexity region 224 256 N/A INTRINSIC
Meta Mutation Damage Score 0.24 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 97% (60/62)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310016G11Rik A G 7: 44,677,196 noncoding transcript Het
5830411N06Rik G A 7: 140,296,397 R594H probably benign Het
Abcc5 T A 16: 20,378,661 K647* probably null Het
Aplp1 A G 7: 30,435,816 probably benign Het
Arhgef25 A G 10: 127,189,554 I43T probably benign Het
BC003965 A G 17: 25,184,983 E99G possibly damaging Het
Brinp3 T G 1: 146,901,451 S545R probably benign Het
Btnl1 A G 17: 34,379,494 E28G probably benign Het
C5ar2 A G 7: 16,237,676 F109L probably benign Het
D630045J12Rik G A 6: 38,183,967 Q1081* probably null Het
Dhx36 T C 3: 62,477,595 I699V possibly damaging Het
Dnah9 A G 11: 65,969,979 I2855T probably benign Het
Dock8 T C 19: 25,163,047 I1317T probably benign Het
Galnt11 A T 5: 25,248,857 D27V probably damaging Het
Gm5134 T A 10: 75,993,884 C335S probably damaging Het
Hdhd2 A T 18: 76,970,615 K227N probably damaging Het
Impg1 A T 9: 80,435,426 L36Q probably damaging Het
Krtcap3 A G 5: 31,252,959 H227R probably benign Het
Lrrc7 A G 3: 158,160,661 Y1148H probably damaging Het
Map2k4 A G 11: 65,712,284 I174T probably damaging Het
Mef2c C A 13: 83,656,240 L282M probably damaging Het
Nqo2 T C 13: 33,981,507 I129T probably benign Het
Pdgfrb T A 18: 61,064,926 probably benign Het
Phf7 C T 14: 31,238,486 probably benign Het
Plac8 T A 5: 100,556,568 T88S probably benign Het
Pou2f1 G A 1: 165,876,018 T654M probably damaging Het
Ptprk T A 10: 28,592,895 V1425E probably damaging Het
Saal1 A T 7: 46,692,892 S376T probably damaging Het
Serpini1 T C 3: 75,619,313 Y291H probably damaging Het
Siah2 T C 3: 58,676,292 H191R probably benign Het
Spaca6 T A 17: 17,838,236 Y39* probably null Het
Tbc1d10a T C 11: 4,213,680 C277R probably damaging Het
Trim45 A T 3: 100,925,420 D323V probably damaging Het
Trim55 A C 3: 19,644,702 M32L probably benign Het
Unc5b T C 10: 60,778,919 T200A probably benign Het
V1rd19 A T 7: 24,003,604 D165V probably damaging Het
Other mutations in AU019823
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02879:AU019823 APN 9 50609371 critical splice donor site probably null
IGL03182:AU019823 APN 9 50612398 missense possibly damaging 0.91
R0021:AU019823 UTSW 9 50610425 missense probably damaging 0.96
R0280:AU019823 UTSW 9 50609379 missense probably damaging 1.00
R0304:AU019823 UTSW 9 50607922 missense probably damaging 0.99
R1438:AU019823 UTSW 9 50607672 missense possibly damaging 0.72
R1613:AU019823 UTSW 9 50607805 missense probably damaging 1.00
R4941:AU019823 UTSW 9 50607509 missense probably benign 0.00
R5983:AU019823 UTSW 9 50607842 missense probably damaging 0.96
R6226:AU019823 UTSW 9 50607770 missense possibly damaging 0.53
R6228:AU019823 UTSW 9 50607671 missense possibly damaging 0.73
R6318:AU019823 UTSW 9 50607461 missense probably benign 0.00
R6923:AU019823 UTSW 9 50610310 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTCACAAGCATGTAGTCACAAACCTG -3'
(R):5'- TTGCAGCCTTGACTCTGGAAGGTG -3'

Sequencing Primer
(F):5'- CATGTAGTCACAAACCTGTCTGG -3'
(R):5'- ccgcctgcctctgcttc -3'
Posted On2013-08-06