Incidental Mutation 'R0023:Vmn2r3'
ID64817
Institutional Source Beutler Lab
Gene Symbol Vmn2r3
Ensembl Gene ENSMUSG00000091572
Gene Namevomeronasal 2, receptor 3
SynonymsEG637004
MMRRC Submission 038318-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0023 (G1)
Quality Score96
Status Validated
Chromosome3
Chromosomal Location64258961-64287495 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 64275366 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 304 (N304I)
Ref Sequence ENSEMBL: ENSMUSP00000134891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170244] [ENSMUST00000176328]
Predicted Effect probably damaging
Transcript: ENSMUST00000170244
AA Change: N276I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126165
Gene: ENSMUSG00000091572
AA Change: N276I

DomainStartEndE-ValueType
Pfam:ANF_receptor 64 479 4e-64 PFAM
Pfam:NCD3G 521 574 1.1e-17 PFAM
Pfam:7tm_3 605 842 2.9e-75 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176328
AA Change: N304I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134891
Gene: ENSMUSG00000091572
AA Change: N304I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 92 507 9.5e-66 PFAM
Pfam:NCD3G 549 602 8.8e-17 PFAM
Pfam:7tm_3 635 869 8.5e-48 PFAM
Meta Mutation Damage Score 0.424 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.2%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik A C 4: 144,528,997 D329A probably damaging Het
Abcc12 T A 8: 86,538,333 H661L probably damaging Het
Abcg4 A G 9: 44,275,375 Y491H probably damaging Het
Acsbg2 C G 17: 56,847,710 A481P probably damaging Het
Aknad1 T A 3: 108,781,185 C610S probably benign Het
Ang4 G T 14: 51,764,403 Y29* probably null Het
Aqp11 A T 7: 97,726,689 I251N possibly damaging Het
Arid1a G T 4: 133,691,176 T1032K unknown Het
Atg16l1 T C 1: 87,789,465 V538A probably benign Het
Bbs1 C T 19: 4,906,014 A44T probably damaging Het
Bpifa3 A C 2: 154,138,150 H234P probably damaging Het
Btbd9 A T 17: 30,530,214 V42E probably damaging Het
Carmil3 C G 14: 55,492,876 S15R probably damaging Het
Casp8ap2 A G 4: 32,640,185 D413G probably damaging Het
Cfap44 T A 16: 44,421,220 F651L probably benign Het
Clcn3 A T 8: 60,933,070 probably benign Het
Crip3 A G 17: 46,430,994 K136E probably damaging Het
Ctr9 G A 7: 111,043,947 A509T possibly damaging Het
D930020B18Rik T C 10: 121,689,821 S367P probably damaging Het
Dhrs11 A T 11: 84,823,150 L125H probably damaging Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Efcab7 A T 4: 99,901,637 probably benign Het
Eif2ak4 A C 2: 118,462,721 S1253R probably damaging Het
Emc1 A G 4: 139,371,009 D767G probably damaging Het
Fads1 G A 19: 10,186,897 probably benign Het
Fbxw26 T C 9: 109,718,011 T449A probably benign Het
Frrs1 T C 3: 116,896,788 F27L probably damaging Het
Fry T C 5: 150,451,098 S2358P possibly damaging Het
Gas6 A C 8: 13,470,344 L448R probably damaging Het
Hikeshi T C 7: 89,920,204 probably benign Het
Ifngr1 C T 10: 19,609,449 R399* probably null Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Knl1 C T 2: 119,102,549 T2063I possibly damaging Het
Lyzl6 A G 11: 103,636,871 V9A probably benign Het
Macf1 A T 4: 123,488,314 probably benign Het
Myo6 T C 9: 80,283,534 V789A possibly damaging Het
Myo9b A T 8: 71,333,768 R693W probably damaging Het
Nasp A G 4: 116,605,771 probably benign Het
Nr1i3 T C 1: 171,217,331 F247L probably damaging Het
Plekhs1 T G 19: 56,478,516 S260A probably damaging Het
Rpl21-ps6 T C 17: 55,915,536 noncoding transcript Het
Rtcb A T 10: 85,949,451 probably benign Het
Sppl2a T A 2: 126,913,293 probably null Het
Suco A T 1: 161,845,585 probably null Het
Tnn T A 1: 160,104,928 T1075S probably benign Het
Traf3 T A 12: 111,243,478 C169* probably null Het
Ucp3 G T 7: 100,485,043 V288L probably benign Het
Ulk3 C A 9: 57,590,356 C4* probably null Het
Vmn1r73 A T 7: 11,757,070 T272S probably benign Het
Vmn2r115 G A 17: 23,346,278 E380K probably benign Het
Xylt1 G T 7: 117,634,701 G485V probably damaging Het
Yars A G 4: 129,197,188 T130A probably benign Het
Zfp652 A T 11: 95,753,469 R205* probably null Het
Other mutations in Vmn2r3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Vmn2r3 APN 3 64259883 missense probably damaging 1.00
IGL01468:Vmn2r3 APN 3 64274961 missense possibly damaging 0.57
IGL02032:Vmn2r3 APN 3 64275055 missense possibly damaging 0.95
IGL02405:Vmn2r3 APN 3 64271199 splice site probably benign
IGL02640:Vmn2r3 APN 3 64287395 missense probably benign
IGL02719:Vmn2r3 APN 3 64275610 missense probably damaging 1.00
IGL02746:Vmn2r3 APN 3 64259818 missense possibly damaging 0.74
IGL02952:Vmn2r3 APN 3 64278835 missense probably damaging 1.00
IGL03390:Vmn2r3 APN 3 64275346 missense possibly damaging 0.55
R0433:Vmn2r3 UTSW 3 64275633 missense possibly damaging 0.51
R0647:Vmn2r3 UTSW 3 64275625 missense probably damaging 1.00
R1071:Vmn2r3 UTSW 3 64275276 missense possibly damaging 0.79
R1536:Vmn2r3 UTSW 3 64275117 missense probably damaging 1.00
R1806:Vmn2r3 UTSW 3 64275472 missense probably benign 0.03
R1806:Vmn2r3 UTSW 3 64287389 missense possibly damaging 0.73
R1852:Vmn2r3 UTSW 3 64259394 missense probably damaging 1.00
R1868:Vmn2r3 UTSW 3 64259116 missense probably damaging 1.00
R2072:Vmn2r3 UTSW 3 64275072 missense possibly damaging 0.87
R2240:Vmn2r3 UTSW 3 64259062 missense probably benign 0.44
R2446:Vmn2r3 UTSW 3 64275312 missense probably damaging 0.98
R4133:Vmn2r3 UTSW 3 64275717 missense probably damaging 0.99
R4159:Vmn2r3 UTSW 3 64287429 nonsense probably null
R4494:Vmn2r3 UTSW 3 64275271 missense probably damaging 1.00
R4860:Vmn2r3 UTSW 3 64275601 missense probably benign 0.00
R4895:Vmn2r3 UTSW 3 64259761 missense probably benign 0.00
R4912:Vmn2r3 UTSW 3 64259197 missense probably damaging 1.00
R5018:Vmn2r3 UTSW 3 64271353 missense probably benign
R5033:Vmn2r3 UTSW 3 64259799 missense probably benign 0.09
R5126:Vmn2r3 UTSW 3 64259319 missense probably damaging 1.00
R5148:Vmn2r3 UTSW 3 64278826 missense probably damaging 1.00
R5414:Vmn2r3 UTSW 3 64259557 nonsense probably null
R5785:Vmn2r3 UTSW 3 64259023 missense possibly damaging 0.89
R5905:Vmn2r3 UTSW 3 64275277 missense probably benign 0.19
R5992:Vmn2r3 UTSW 3 64259647 missense probably damaging 1.00
R6028:Vmn2r3 UTSW 3 64275277 missense probably benign 0.19
R6331:Vmn2r3 UTSW 3 64278761 missense probably damaging 1.00
R6378:Vmn2r3 UTSW 3 64275096 missense probably damaging 1.00
R6775:Vmn2r3 UTSW 3 64275618 missense possibly damaging 0.88
R6822:Vmn2r3 UTSW 3 64287455 missense probably benign 0.30
R6826:Vmn2r3 UTSW 3 64274906 nonsense probably null
R6886:Vmn2r3 UTSW 3 64259506 missense probably damaging 1.00
R6971:Vmn2r3 UTSW 3 64259247 missense probably damaging 0.99
R7154:Vmn2r3 UTSW 3 64287311 missense probably benign 0.02
R7192:Vmn2r3 UTSW 3 64259943 missense probably benign 0.24
R7282:Vmn2r3 UTSW 3 64261404 missense possibly damaging 0.90
R7472:Vmn2r3 UTSW 3 64275532 missense not run
R7563:Vmn2r3 UTSW 3 64275349 missense not run
X0022:Vmn2r3 UTSW 3 64271248 missense possibly damaging 0.62
X0022:Vmn2r3 UTSW 3 64274968 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCTCCTTTCCAGTGCAGAGATG -3'
(R):5'- TCAGGTGGGATATGCTTCCTCCTC -3'

Sequencing Primer
(F):5'- TTCCAGTGCAGAGATGATCTGAC -3'
(R):5'- GTTTATCGCACAATACCCAGTG -3'
Posted On2013-08-06