Incidental Mutation 'R0023:Casp8ap2'
ID64820
Institutional Source Beutler Lab
Gene Symbol Casp8ap2
Ensembl Gene ENSMUSG00000028282
Gene Namecaspase 8 associated protein 2
SynonymsFLASH, D4Ertd659e
MMRRC Submission 038318-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0023 (G1)
Quality Score124
Status Validated
Chromosome4
Chromosomal Location32615451-32653265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32640185 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 413 (D413G)
Ref Sequence ENSEMBL: ENSMUSP00000136016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029950] [ENSMUST00000108178] [ENSMUST00000178925]
Predicted Effect probably damaging
Transcript: ENSMUST00000029950
AA Change: D413G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029950
Gene: ENSMUSG00000028282
AA Change: D413G

DomainStartEndE-ValueType
coiled coil region 68 142 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 458 477 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1250 1268 N/A INTRINSIC
low complexity region 1360 1377 N/A INTRINSIC
low complexity region 1458 1470 N/A INTRINSIC
low complexity region 1477 1498 N/A INTRINSIC
low complexity region 1882 1895 N/A INTRINSIC
PDB:2LR8|A 1896 1962 1e-31 PDB
Blast:SANT 1905 1955 2e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000108178
SMART Domains Protein: ENSMUSP00000103813
Gene: ENSMUSG00000028282

DomainStartEndE-ValueType
PDB:2LR8|A 126 190 4e-26 PDB
Blast:SANT 139 183 4e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127619
Predicted Effect probably damaging
Transcript: ENSMUST00000178925
AA Change: D413G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136016
Gene: ENSMUSG00000028282
AA Change: D413G

DomainStartEndE-ValueType
coiled coil region 68 142 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 458 477 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1250 1268 N/A INTRINSIC
low complexity region 1360 1377 N/A INTRINSIC
low complexity region 1458 1470 N/A INTRINSIC
low complexity region 1477 1498 N/A INTRINSIC
low complexity region 1882 1895 N/A INTRINSIC
PDB:2LR8|A 1896 1962 1e-31 PDB
Blast:SANT 1905 1955 2e-21 BLAST
Meta Mutation Damage Score 0.312 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is highly similar to FLASH, a mouse apoptotic protein identified by its interaction with the death-effector domain (DED) of caspase 8. Studies of FLASH protein suggested that this protein may be a component of the death-inducing signaling complex that includes Fas receptor, Fas-binding adapter FADD, and caspase 8, and plays a regulatory role in Fas-mediated apoptosis. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik A C 4: 144,528,997 D329A probably damaging Het
Abcc12 T A 8: 86,538,333 H661L probably damaging Het
Abcg4 A G 9: 44,275,375 Y491H probably damaging Het
Acsbg2 C G 17: 56,847,710 A481P probably damaging Het
Aknad1 T A 3: 108,781,185 C610S probably benign Het
Ang4 G T 14: 51,764,403 Y29* probably null Het
Aqp11 A T 7: 97,726,689 I251N possibly damaging Het
Arid1a G T 4: 133,691,176 T1032K unknown Het
Atg16l1 T C 1: 87,789,465 V538A probably benign Het
Bbs1 C T 19: 4,906,014 A44T probably damaging Het
Bpifa3 A C 2: 154,138,150 H234P probably damaging Het
Btbd9 A T 17: 30,530,214 V42E probably damaging Het
Carmil3 C G 14: 55,492,876 S15R probably damaging Het
Cfap44 T A 16: 44,421,220 F651L probably benign Het
Clcn3 A T 8: 60,933,070 probably benign Het
Crip3 A G 17: 46,430,994 K136E probably damaging Het
Ctr9 G A 7: 111,043,947 A509T possibly damaging Het
D930020B18Rik T C 10: 121,689,821 S367P probably damaging Het
Dhrs11 A T 11: 84,823,150 L125H probably damaging Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Efcab7 A T 4: 99,901,637 probably benign Het
Eif2ak4 A C 2: 118,462,721 S1253R probably damaging Het
Emc1 A G 4: 139,371,009 D767G probably damaging Het
Fads1 G A 19: 10,186,897 probably benign Het
Fbxw26 T C 9: 109,718,011 T449A probably benign Het
Frrs1 T C 3: 116,896,788 F27L probably damaging Het
Fry T C 5: 150,451,098 S2358P possibly damaging Het
Gas6 A C 8: 13,470,344 L448R probably damaging Het
Hikeshi T C 7: 89,920,204 probably benign Het
Ifngr1 C T 10: 19,609,449 R399* probably null Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Knl1 C T 2: 119,102,549 T2063I possibly damaging Het
Lyzl6 A G 11: 103,636,871 V9A probably benign Het
Macf1 A T 4: 123,488,314 probably benign Het
Myo6 T C 9: 80,283,534 V789A possibly damaging Het
Myo9b A T 8: 71,333,768 R693W probably damaging Het
Nasp A G 4: 116,605,771 probably benign Het
Nr1i3 T C 1: 171,217,331 F247L probably damaging Het
Plekhs1 T G 19: 56,478,516 S260A probably damaging Het
Rpl21-ps6 T C 17: 55,915,536 noncoding transcript Het
Rtcb A T 10: 85,949,451 probably benign Het
Sppl2a T A 2: 126,913,293 probably null Het
Suco A T 1: 161,845,585 probably null Het
Tnn T A 1: 160,104,928 T1075S probably benign Het
Traf3 T A 12: 111,243,478 C169* probably null Het
Ucp3 G T 7: 100,485,043 V288L probably benign Het
Ulk3 C A 9: 57,590,356 C4* probably null Het
Vmn1r73 A T 7: 11,757,070 T272S probably benign Het
Vmn2r115 G A 17: 23,346,278 E380K probably benign Het
Vmn2r3 T A 3: 64,275,366 N304I probably damaging Het
Xylt1 G T 7: 117,634,701 G485V probably damaging Het
Yars A G 4: 129,197,188 T130A probably benign Het
Zfp652 A T 11: 95,753,469 R205* probably null Het
Other mutations in Casp8ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00686:Casp8ap2 APN 4 32641433 missense probably damaging 1.00
IGL00714:Casp8ap2 APN 4 32649192 missense probably damaging 1.00
IGL00754:Casp8ap2 APN 4 32641036 missense probably benign 0.00
IGL00954:Casp8ap2 APN 4 32645403 missense probably damaging 1.00
IGL00970:Casp8ap2 APN 4 32646182 missense probably benign
IGL01534:Casp8ap2 APN 4 32648134 splice site probably benign
IGL01596:Casp8ap2 APN 4 32646365 missense probably damaging 1.00
IGL01686:Casp8ap2 APN 4 32641294 missense possibly damaging 0.94
IGL02002:Casp8ap2 APN 4 32639391 missense probably damaging 1.00
IGL02273:Casp8ap2 APN 4 32643974 missense probably damaging 1.00
IGL02510:Casp8ap2 APN 4 32639704 missense probably benign 0.05
IGL02600:Casp8ap2 APN 4 32630246 missense probably null 1.00
IGL02929:Casp8ap2 APN 4 32624105 utr 5 prime probably benign
F5770:Casp8ap2 UTSW 4 32639944 missense probably benign 0.00
IGL02988:Casp8ap2 UTSW 4 32644590 missense probably benign 0.14
R0027:Casp8ap2 UTSW 4 32643810 missense probably benign 0.01
R0090:Casp8ap2 UTSW 4 32640327 missense probably damaging 1.00
R0117:Casp8ap2 UTSW 4 32640817 missense probably benign 0.00
R0144:Casp8ap2 UTSW 4 32643797 missense possibly damaging 0.50
R0268:Casp8ap2 UTSW 4 32644079 missense probably damaging 0.99
R0344:Casp8ap2 UTSW 4 32644079 missense probably damaging 0.99
R0555:Casp8ap2 UTSW 4 32640381 missense probably damaging 1.00
R1051:Casp8ap2 UTSW 4 32640790 missense probably benign 0.28
R1165:Casp8ap2 UTSW 4 32640563 missense probably benign 0.01
R1243:Casp8ap2 UTSW 4 32645687 missense probably benign 0.03
R1311:Casp8ap2 UTSW 4 32648111 missense probably damaging 0.98
R1337:Casp8ap2 UTSW 4 32645721 missense possibly damaging 0.64
R1471:Casp8ap2 UTSW 4 32639386 nonsense probably null
R1497:Casp8ap2 UTSW 4 32639938 missense probably benign 0.00
R1521:Casp8ap2 UTSW 4 32631867 missense probably damaging 1.00
R1588:Casp8ap2 UTSW 4 32640541 missense probably benign 0.00
R1625:Casp8ap2 UTSW 4 32648068 missense probably benign 0.04
R1731:Casp8ap2 UTSW 4 32641442 missense possibly damaging 0.94
R1899:Casp8ap2 UTSW 4 32643647 missense probably damaging 0.98
R2000:Casp8ap2 UTSW 4 32634874 missense probably damaging 1.00
R2021:Casp8ap2 UTSW 4 32644560 missense probably benign 0.05
R2022:Casp8ap2 UTSW 4 32644560 missense probably benign 0.05
R2023:Casp8ap2 UTSW 4 32644560 missense probably benign 0.05
R2088:Casp8ap2 UTSW 4 32631126 missense probably damaging 1.00
R2104:Casp8ap2 UTSW 4 32644727 missense probably benign 0.00
R2128:Casp8ap2 UTSW 4 32640142 missense probably benign 0.06
R2129:Casp8ap2 UTSW 4 32640142 missense probably benign 0.06
R2305:Casp8ap2 UTSW 4 32646411 missense probably damaging 1.00
R2316:Casp8ap2 UTSW 4 32643781 missense probably benign 0.31
R2919:Casp8ap2 UTSW 4 32645343 missense probably damaging 1.00
R4091:Casp8ap2 UTSW 4 32643611 missense probably damaging 1.00
R4357:Casp8ap2 UTSW 4 32646150 missense probably benign 0.00
R4807:Casp8ap2 UTSW 4 32644505 missense possibly damaging 0.89
R4828:Casp8ap2 UTSW 4 32639807 missense probably benign
R4908:Casp8ap2 UTSW 4 32639905 missense possibly damaging 0.90
R4945:Casp8ap2 UTSW 4 32631163 missense possibly damaging 0.57
R4962:Casp8ap2 UTSW 4 32640554 missense probably damaging 0.99
R6014:Casp8ap2 UTSW 4 32641400 missense probably damaging 0.97
R6092:Casp8ap2 UTSW 4 32639380 missense probably damaging 1.00
R6257:Casp8ap2 UTSW 4 32641364 missense possibly damaging 0.94
R6289:Casp8ap2 UTSW 4 32639590 missense probably damaging 1.00
R6482:Casp8ap2 UTSW 4 32634813 missense probably damaging 1.00
R6496:Casp8ap2 UTSW 4 32641553 missense probably benign 0.05
R6515:Casp8ap2 UTSW 4 32646423 missense possibly damaging 0.64
R7015:Casp8ap2 UTSW 4 32644278 missense probably damaging 1.00
R7033:Casp8ap2 UTSW 4 32639392 missense probably damaging 1.00
R7072:Casp8ap2 UTSW 4 32644766 missense probably damaging 1.00
V7580:Casp8ap2 UTSW 4 32639944 missense probably benign 0.00
X0018:Casp8ap2 UTSW 4 32643738 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGCTTCCGTCTCAGGACAAAACAG -3'
(R):5'- TGGGTTATCTTGACAAGCAGGCTG -3'

Sequencing Primer
(F):5'- TCTCAGGACAAAACAGAAAGAAAAG -3'
(R):5'- AGCTCACTGTTAGAGACTGC -3'
Posted On2013-08-06