Incidental Mutation 'R0023:Ucp3'
ID64826
Institutional Source Beutler Lab
Gene Symbol Ucp3
Ensembl Gene ENSMUSG00000032942
Gene Nameuncoupling protein 3 (mitochondrial, proton carrier)
SynonymsUCP-3, Slc25a9
MMRRC Submission 038318-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R0023 (G1)
Quality Score205
Status Validated
Chromosome7
Chromosomal Location100472990-100486432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 100485043 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 288 (V288L)
Ref Sequence ENSEMBL: ENSMUSP00000102674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032958] [ENSMUST00000107059]
Predicted Effect probably benign
Transcript: ENSMUST00000032958
AA Change: V288L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000032958
Gene: ENSMUSG00000032942
AA Change: V288L

DomainStartEndE-ValueType
Pfam:Mito_carr 10 107 3.1e-20 PFAM
Pfam:Mito_carr 109 207 9.6e-26 PFAM
Pfam:Mito_carr 210 301 2.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107059
AA Change: V288L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000102674
Gene: ENSMUSG00000032942
AA Change: V288L

DomainStartEndE-ValueType
Pfam:Mito_carr 9 107 5.9e-22 PFAM
Pfam:Mito_carr 109 207 1.7e-27 PFAM
Pfam:Mito_carr 209 301 9.4e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133850
Meta Mutation Damage Score 0.042 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. The different UCPs have tissue-specific expression; this gene is primarily expressed in skeletal muscle. This gene's protein product is postulated to protect mitochondria against lipid-induced oxidative stress. Expression levels of this gene increase when fatty acid supplies to mitochondria exceed their oxidation capacity and the protein enables the export of fatty acids from mitochondria. UCPs contain the three solcar protein domains typically found in MACPs. Two splice variants have been found for this gene.[provided by RefSeq, Nov 2008]
PHENOTYPE: Homozygous null mutants exhibit a lack of superoxide-induced uncoupling in skeletal muscle mitochondria, accompanied by increased reactive oxygen species formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik A C 4: 144,528,997 D329A probably damaging Het
Abcc12 T A 8: 86,538,333 H661L probably damaging Het
Abcg4 A G 9: 44,275,375 Y491H probably damaging Het
Acsbg2 C G 17: 56,847,710 A481P probably damaging Het
Aknad1 T A 3: 108,781,185 C610S probably benign Het
Ang4 G T 14: 51,764,403 Y29* probably null Het
Aqp11 A T 7: 97,726,689 I251N possibly damaging Het
Arid1a G T 4: 133,691,176 T1032K unknown Het
Atg16l1 T C 1: 87,789,465 V538A probably benign Het
Bbs1 C T 19: 4,906,014 A44T probably damaging Het
Bpifa3 A C 2: 154,138,150 H234P probably damaging Het
Btbd9 A T 17: 30,530,214 V42E probably damaging Het
Carmil3 C G 14: 55,492,876 S15R probably damaging Het
Casp8ap2 A G 4: 32,640,185 D413G probably damaging Het
Cfap44 T A 16: 44,421,220 F651L probably benign Het
Clcn3 A T 8: 60,933,070 probably benign Het
Crip3 A G 17: 46,430,994 K136E probably damaging Het
Ctr9 G A 7: 111,043,947 A509T possibly damaging Het
D930020B18Rik T C 10: 121,689,821 S367P probably damaging Het
Dhrs11 A T 11: 84,823,150 L125H probably damaging Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Efcab7 A T 4: 99,901,637 probably benign Het
Eif2ak4 A C 2: 118,462,721 S1253R probably damaging Het
Emc1 A G 4: 139,371,009 D767G probably damaging Het
Fads1 G A 19: 10,186,897 probably benign Het
Fbxw26 T C 9: 109,718,011 T449A probably benign Het
Frrs1 T C 3: 116,896,788 F27L probably damaging Het
Fry T C 5: 150,451,098 S2358P possibly damaging Het
Gas6 A C 8: 13,470,344 L448R probably damaging Het
Hikeshi T C 7: 89,920,204 probably benign Het
Ifngr1 C T 10: 19,609,449 R399* probably null Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Knl1 C T 2: 119,102,549 T2063I possibly damaging Het
Lyzl6 A G 11: 103,636,871 V9A probably benign Het
Macf1 A T 4: 123,488,314 probably benign Het
Myo6 T C 9: 80,283,534 V789A possibly damaging Het
Myo9b A T 8: 71,333,768 R693W probably damaging Het
Nasp A G 4: 116,605,771 probably benign Het
Nr1i3 T C 1: 171,217,331 F247L probably damaging Het
Plekhs1 T G 19: 56,478,516 S260A probably damaging Het
Rpl21-ps6 T C 17: 55,915,536 noncoding transcript Het
Rtcb A T 10: 85,949,451 probably benign Het
Sppl2a T A 2: 126,913,293 probably null Het
Suco A T 1: 161,845,585 probably null Het
Tnn T A 1: 160,104,928 T1075S probably benign Het
Traf3 T A 12: 111,243,478 C169* probably null Het
Ulk3 C A 9: 57,590,356 C4* probably null Het
Vmn1r73 A T 7: 11,757,070 T272S probably benign Het
Vmn2r115 G A 17: 23,346,278 E380K probably benign Het
Vmn2r3 T A 3: 64,275,366 N304I probably damaging Het
Xylt1 G T 7: 117,634,701 G485V probably damaging Het
Yars A G 4: 129,197,188 T130A probably benign Het
Zfp652 A T 11: 95,753,469 R205* probably null Het
Other mutations in Ucp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02016:Ucp3 APN 7 100480559 missense probably damaging 1.00
IGL02883:Ucp3 APN 7 100480642 missense probably benign 0.00
IGL03137:Ucp3 APN 7 100482762 splice site probably benign
PIT4576001:Ucp3 UTSW 7 100480251 missense probably benign 0.04
R0023:Ucp3 UTSW 7 100485043 missense probably benign 0.00
R0532:Ucp3 UTSW 7 100481979 splice site probably benign
R0616:Ucp3 UTSW 7 100480161 missense probably benign 0.00
R0833:Ucp3 UTSW 7 100479541 nonsense probably null
R1739:Ucp3 UTSW 7 100482720 missense probably benign 0.01
R1939:Ucp3 UTSW 7 100480664 missense probably benign 0.00
R3861:Ucp3 UTSW 7 100480251 missense probably benign 0.04
R3958:Ucp3 UTSW 7 100482739 missense probably benign 0.00
R3959:Ucp3 UTSW 7 100482739 missense probably benign 0.00
R4059:Ucp3 UTSW 7 100482664 missense probably damaging 0.99
R5535:Ucp3 UTSW 7 100480666 missense probably benign 0.45
R6463:Ucp3 UTSW 7 100480269 missense probably benign 0.00
R6596:Ucp3 UTSW 7 100481933 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGTCGAGAATGAACCTCCTACACAG -3'
(R):5'- TCCCATCAGGTCAGTGCAAAACAG -3'

Sequencing Primer
(F):5'- TGCCTAAATCCCTTCAGTAGAGAG -3'
(R):5'- TCAGTGCAAAACAGAGGTGTTTTAG -3'
Posted On2013-08-06