Incidental Mutation 'R0015:Astn2'
List |< first << previous [record 8 of 76] next >> last >|
ID64891
Institutional Source Beutler Lab
Gene Symbol Astn2
Ensembl Gene ENSMUSG00000028373
Gene Nameastrotactin 2
Synonyms1d8, Astnl
MMRRC Submission 038310-MU
Accession Numbers

Genbank: NM_019514.3, NM_207109.2; Ensembl: ENSMUST00000068214,   ENSMUST00000084496

Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R0015 (G1)
Quality Score147
Status Validated
Chromosome4
Chromosomal Location65380803-66404611 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to G at 66266382 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000081540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068214] [ENSMUST00000084496]
Predicted Effect probably null
Transcript: ENSMUST00000068214
SMART Domains Protein: ENSMUSP00000065786
Gene: ENSMUSG00000028373

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 87 127 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
low complexity region 303 312 N/A INTRINSIC
low complexity region 342 361 N/A INTRINSIC
low complexity region 393 404 N/A INTRINSIC
low complexity region 432 437 N/A INTRINSIC
transmembrane domain 443 465 N/A INTRINSIC
EGF_like 526 563 2.92e1 SMART
Blast:EGF_like 667 708 2e-18 BLAST
EGF_like 715 764 4.03e1 SMART
MACPF 864 1048 2.88e-55 SMART
FN3 1079 1191 2.41e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000084496
SMART Domains Protein: ENSMUSP00000081540
Gene: ENSMUSG00000028373

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 87 127 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
low complexity region 303 312 N/A INTRINSIC
low complexity region 341 352 N/A INTRINSIC
low complexity region 380 385 N/A INTRINSIC
transmembrane domain 391 413 N/A INTRINSIC
EGF_like 474 511 2.92e1 SMART
Blast:EGF_like 615 656 2e-18 BLAST
EGF_like 663 712 4.03e1 SMART
MACPF 812 996 2.88e-55 SMART
FN3 1027 1139 2.41e0 SMART
Meta Mutation Damage Score 0.576 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is expressed in the brain and may function in neuronal migration, based on functional studies of the related astrotactin 1 gene in human and mouse. A deletion at this locus has been associated with schizophrenia. Multiple transcript variants encoding different proteins have been found for this locus. [provided by RefSeq, May 2010]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,186,184 R408H probably damaging Het
A130050O07Rik A G 1: 137,928,656 Y23C unknown Het
Adcy3 G A 12: 4,195,260 probably null Het
Aldh6a1 G A 12: 84,441,780 L86F probably damaging Het
Arl10 G T 13: 54,575,957 probably benign Het
Armc3 A G 2: 19,296,321 probably null Het
Cacna1d G A 14: 30,114,971 T804I probably benign Het
Ccny A C 18: 9,316,682 probably benign Het
Cdh5 C T 8: 104,140,927 T612I probably benign Het
Cfap58 A G 19: 48,029,100 M800V probably benign Het
Clrn1 A T 3: 58,846,427 I171K probably damaging Het
Cnp T A 11: 100,578,908 probably null Het
Col12a1 T C 9: 79,651,385 T1933A probably damaging Het
Cwf19l2 A G 9: 3,454,666 S660G probably benign Het
Dync1i2 C A 2: 71,214,484 R13S probably damaging Het
Eps8l1 A T 7: 4,477,557 probably benign Het
Espn T C 4: 152,139,152 T188A possibly damaging Het
F2 T C 2: 91,630,607 E260G probably benign Het
Fat4 T A 3: 38,982,503 S3435T probably damaging Het
Fchsd1 A G 18: 37,962,959 C533R probably benign Het
Fstl5 G A 3: 76,322,191 V100M probably damaging Het
Gls2 T G 10: 128,209,350 L572R probably damaging Het
Gm20939 A T 17: 94,876,768 E281D probably benign Het
Gpr35 T G 1: 92,983,232 L222W probably damaging Het
Hsf5 C A 11: 87,657,335 H615N probably benign Het
Id2 C T 12: 25,095,803 D70N probably damaging Het
Ints2 T C 11: 86,249,287 T240A probably damaging Het
Kcnn3 A C 3: 89,662,773 D631A probably damaging Het
Klhdc8a A G 1: 132,303,005 T203A probably damaging Het
Lama4 C T 10: 39,075,436 T1059M possibly damaging Het
Lgals8 A G 13: 12,447,298 L226P probably damaging Het
Lifr T A 15: 7,188,186 probably null Het
Lonp1 T A 17: 56,618,406 Q462L probably benign Het
Lypd1 A G 1: 125,910,438 V48A possibly damaging Het
Mapkapk2 A G 1: 131,097,326 I67T possibly damaging Het
Mbd3l1 A T 9: 18,484,858 D93V probably benign Het
Mdh1b T C 1: 63,721,800 probably benign Het
Myh7b C T 2: 155,622,286 P569L probably damaging Het
Ncapd3 C A 9: 27,051,809 A470E probably damaging Het
Ndrg2 A G 14: 51,910,445 probably benign Het
Nprl2 A T 9: 107,544,419 I209F probably damaging Het
Ntrk1 A G 3: 87,791,750 probably benign Het
Olfm2 T C 9: 20,668,741 E268G probably damaging Het
Olfr884 T A 9: 38,047,667 Y148* probably null Het
Pcf11 T A 7: 92,658,317 H881L probably benign Het
Pde10a A G 17: 8,977,197 D640G probably damaging Het
Pde9a G A 17: 31,386,356 probably null Het
Pianp G T 6: 125,001,540 G236V probably damaging Het
Polr2g A G 19: 8,793,652 I160T probably damaging Het
Ppp1r3a A G 6: 14,717,661 S1085P possibly damaging Het
Pter G A 2: 13,001,000 G328D probably damaging Het
Rad51 T A 2: 119,116,327 M5K probably benign Het
Rbm43 T A 2: 51,925,667 I181F probably benign Het
Rgs12 T C 5: 35,022,776 probably benign Het
Rnf213 A C 11: 119,441,606 D2547A possibly damaging Het
Slc20a2 C A 8: 22,535,345 A21E probably damaging Het
Stab2 A G 10: 86,843,617 S2503P probably benign Het
Sv2b A T 7: 75,125,641 F479L probably damaging Het
Sybu T C 15: 44,673,500 R349G probably damaging Het
Tead3 T C 17: 28,341,351 Y2C probably damaging Het
Tnrc6c T A 11: 117,721,458 N307K probably damaging Het
Ubxn11 C G 4: 134,116,025 probably null Het
Ust T C 10: 8,330,065 probably benign Het
Vmn2r116 T A 17: 23,401,849 N852K probably benign Het
Zgrf1 T C 3: 127,555,397 probably benign Het
Other mutations in Astn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Astn2 APN 4 66185187 missense unknown
IGL01657:Astn2 APN 4 65651949 missense probably damaging 0.99
IGL01747:Astn2 APN 4 65794618 missense probably benign 0.17
IGL02008:Astn2 APN 4 66059153 missense probably damaging 1.00
IGL02215:Astn2 APN 4 66266234 missense unknown
IGL02484:Astn2 APN 4 65992279 splice site probably benign
IGL02494:Astn2 APN 4 65992348 missense probably benign 0.23
IGL02792:Astn2 APN 4 65644821 missense probably benign 0.32
IGL03248:Astn2 APN 4 65746293 splice site probably benign
IGL03409:Astn2 APN 4 65435186 missense possibly damaging 0.46
B6584:Astn2 UTSW 4 65992387 missense probably damaging 0.99
R0015:Astn2 UTSW 4 66266382 critical splice acceptor site probably null
R0092:Astn2 UTSW 4 66403982 missense unknown
R0245:Astn2 UTSW 4 65794558 missense probably damaging 0.99
R0528:Astn2 UTSW 4 65644882 splice site probably benign
R0586:Astn2 UTSW 4 66185142 missense unknown
R0652:Astn2 UTSW 4 65794558 missense probably damaging 0.99
R0880:Astn2 UTSW 4 65648330 missense probably damaging 0.99
R0931:Astn2 UTSW 4 65648293 missense probably damaging 0.99
R1353:Astn2 UTSW 4 66266335 missense unknown
R1700:Astn2 UTSW 4 65746354 nonsense probably null
R1934:Astn2 UTSW 4 65435189 missense probably damaging 0.99
R2017:Astn2 UTSW 4 65540941 missense probably damaging 0.99
R2101:Astn2 UTSW 4 65581686 nonsense probably null
R2158:Astn2 UTSW 4 66404254 missense unknown
R2907:Astn2 UTSW 4 65644856 missense possibly damaging 0.92
R2923:Astn2 UTSW 4 65913773 missense probably damaging 1.00
R2938:Astn2 UTSW 4 65992313 missense possibly damaging 0.92
R3033:Astn2 UTSW 4 65644706 missense probably damaging 1.00
R3933:Astn2 UTSW 4 66403955 missense unknown
R4151:Astn2 UTSW 4 65729320 critical splice donor site probably null
R4230:Astn2 UTSW 4 65911682 missense probably damaging 0.99
R4497:Astn2 UTSW 4 66119063 intron probably benign
R4717:Astn2 UTSW 4 65644754 missense possibly damaging 0.86
R4844:Astn2 UTSW 4 65644730 missense possibly damaging 0.90
R4928:Astn2 UTSW 4 65729407 missense probably damaging 0.98
R5374:Astn2 UTSW 4 65397005 missense probably damaging 0.96
R5442:Astn2 UTSW 4 65581786 missense possibly damaging 0.86
R5694:Astn2 UTSW 4 65950138 missense probably damaging 1.00
R5756:Astn2 UTSW 4 66119188 intron probably benign
R5763:Astn2 UTSW 4 65729331 missense probably benign 0.14
R6089:Astn2 UTSW 4 65794573 missense probably damaging 0.96
R6990:Astn2 UTSW 4 65992303 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CATGCTCAGGTACTCACCATCACAG -3'
(R):5'- TGAAGATCAAGTGTTGCCTCTCGTC -3'

Sequencing Primer
(F):5'- TCACCATCACAGAAATGTGGAG -3'
(R):5'- CGTCTTGTGTTACTTGAGAAATATCG -3'
Posted On2013-08-06