Incidental Mutation 'R0015:Olfr884'
List |< first << previous [record 51 of 76] next >> last >|
ID64904
Institutional Source Beutler Lab
Gene Symbol Olfr884
Ensembl Gene ENSMUSG00000095893
Gene Nameolfactory receptor 884
SynonymsMOR162-13, MOR162-9P, Olfr1550-ps1, MOR162-11P, MOR162-11P, GA_x6K02T2PVTD-31726544-31727473
MMRRC Submission 038310-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R0015 (G1)
Quality Score209
Status Validated
Chromosome9
Chromosomal Location38046555-38050137 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 38047667 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 148 (Y148*)
Ref Sequence ENSEMBL: ENSMUSP00000138035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077732] [ENSMUST00000181088]
Predicted Effect probably null
Transcript: ENSMUST00000077732
AA Change: Y148*
SMART Domains Protein: ENSMUSP00000076912
Gene: ENSMUSG00000095893
AA Change: Y148*

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 8e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 300 1.5e-6 PFAM
Pfam:7tm_1 41 288 5.1e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000181088
AA Change: Y148*
SMART Domains Protein: ENSMUSP00000138035
Gene: ENSMUSG00000095893
AA Change: Y148*

DomainStartEndE-ValueType
low complexity region 14 33 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 35 300 1.5e-6 PFAM
Pfam:7tm_1 41 288 4.6e-30 PFAM
Pfam:7tm_4 138 281 3.9e-45 PFAM
Meta Mutation Damage Score 0.6348 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,186,184 R408H probably damaging Het
A130050O07Rik A G 1: 137,928,656 Y23C unknown Het
Adcy3 G A 12: 4,195,260 probably null Het
Aldh6a1 G A 12: 84,441,780 L86F probably damaging Het
Arl10 G T 13: 54,575,957 probably benign Het
Armc3 A G 2: 19,296,321 probably null Het
Astn2 T G 4: 66,266,382 probably null Het
Cacna1d G A 14: 30,114,971 T804I probably benign Het
Ccny A C 18: 9,316,682 probably benign Het
Cdh5 C T 8: 104,140,927 T612I probably benign Het
Cfap58 A G 19: 48,029,100 M800V probably benign Het
Clrn1 A T 3: 58,846,427 I171K probably damaging Het
Cnp T A 11: 100,578,908 probably null Het
Col12a1 T C 9: 79,651,385 T1933A probably damaging Het
Cwf19l2 A G 9: 3,454,666 S660G probably benign Het
Dync1i2 C A 2: 71,214,484 R13S probably damaging Het
Eps8l1 A T 7: 4,477,557 probably benign Het
Espn T C 4: 152,139,152 T188A possibly damaging Het
F2 T C 2: 91,630,607 E260G probably benign Het
Fat4 T A 3: 38,982,503 S3435T probably damaging Het
Fchsd1 A G 18: 37,962,959 C533R probably benign Het
Fstl5 G A 3: 76,322,191 V100M probably damaging Het
Gls2 T G 10: 128,209,350 L572R probably damaging Het
Gm20939 A T 17: 94,876,768 E281D probably benign Het
Gpr35 T G 1: 92,983,232 L222W probably damaging Het
Hsf5 C A 11: 87,657,335 H615N probably benign Het
Id2 C T 12: 25,095,803 D70N probably damaging Het
Ints2 T C 11: 86,249,287 T240A probably damaging Het
Kcnn3 A C 3: 89,662,773 D631A probably damaging Het
Klhdc8a A G 1: 132,303,005 T203A probably damaging Het
Lama4 C T 10: 39,075,436 T1059M possibly damaging Het
Lgals8 A G 13: 12,447,298 L226P probably damaging Het
Lifr T A 15: 7,188,186 probably null Het
Lonp1 T A 17: 56,618,406 Q462L probably benign Het
Lypd1 A G 1: 125,910,438 V48A possibly damaging Het
Mapkapk2 A G 1: 131,097,326 I67T possibly damaging Het
Mbd3l1 A T 9: 18,484,858 D93V probably benign Het
Mdh1b T C 1: 63,721,800 probably benign Het
Myh7b C T 2: 155,622,286 P569L probably damaging Het
Ncapd3 C A 9: 27,051,809 A470E probably damaging Het
Ndrg2 A G 14: 51,910,445 probably benign Het
Nprl2 A T 9: 107,544,419 I209F probably damaging Het
Ntrk1 A G 3: 87,791,750 probably benign Het
Olfm2 T C 9: 20,668,741 E268G probably damaging Het
Pcf11 T A 7: 92,658,317 H881L probably benign Het
Pde10a A G 17: 8,977,197 D640G probably damaging Het
Pde9a G A 17: 31,386,356 probably null Het
Pianp G T 6: 125,001,540 G236V probably damaging Het
Polr2g A G 19: 8,793,652 I160T probably damaging Het
Ppp1r3a A G 6: 14,717,661 S1085P possibly damaging Het
Pter G A 2: 13,001,000 G328D probably damaging Het
Rad51 T A 2: 119,116,327 M5K probably benign Het
Rbm43 T A 2: 51,925,667 I181F probably benign Het
Rgs12 T C 5: 35,022,776 probably benign Het
Rnf213 A C 11: 119,441,606 D2547A possibly damaging Het
Slc20a2 C A 8: 22,535,345 A21E probably damaging Het
Stab2 A G 10: 86,843,617 S2503P probably benign Het
Sv2b A T 7: 75,125,641 F479L probably damaging Het
Sybu T C 15: 44,673,500 R349G probably damaging Het
Tead3 T C 17: 28,341,351 Y2C probably damaging Het
Tnrc6c T A 11: 117,721,458 N307K probably damaging Het
Ubxn11 C G 4: 134,116,025 probably null Het
Ust T C 10: 8,330,065 probably benign Het
Vmn2r116 T A 17: 23,401,849 N852K probably benign Het
Zgrf1 T C 3: 127,555,397 probably benign Het
Other mutations in Olfr884
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Olfr884 APN 9 38047740 missense probably damaging 1.00
IGL02612:Olfr884 APN 9 38047366 missense probably damaging 1.00
IGL02802:Olfr884 UTSW 9 38048049 missense probably damaging 0.99
R0142:Olfr884 UTSW 9 38048110 missense probably benign 0.37
R0559:Olfr884 UTSW 9 38047827 missense probably benign 0.16
R0561:Olfr884 UTSW 9 38047827 missense probably benign 0.16
R0715:Olfr884 UTSW 9 38047827 missense probably benign 0.16
R0723:Olfr884 UTSW 9 38047827 missense probably benign 0.16
R0729:Olfr884 UTSW 9 38047827 missense probably benign 0.16
R1350:Olfr884 UTSW 9 38047815 missense probably benign 0.02
R1869:Olfr884 UTSW 9 38048202 unclassified probably null
R3917:Olfr884 UTSW 9 38047545 missense probably damaging 1.00
R4131:Olfr884 UTSW 9 38047874 nonsense probably null
R4764:Olfr884 UTSW 9 38048140 missense probably benign
R5857:Olfr884 UTSW 9 38047753 missense probably benign 0.18
R5976:Olfr884 UTSW 9 38047701 missense possibly damaging 0.80
R6329:Olfr884 UTSW 9 38047825 missense probably benign 0.02
X0052:Olfr884 UTSW 9 38047699 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- CTATGTGGTCTCCATGTTGGGGAAC -3'
(R):5'- AAGAGAGTCAGGCTGGGCACTATC -3'

Sequencing Primer
(F):5'- CATAACCCCTAGAATGTTGGTGG -3'
(R):5'- GCTGGGCACTATCACATTGAC -3'
Posted On2013-08-06