Incidental Mutation 'R0015:Pde10a'
ID64918
Institutional Source Beutler Lab
Gene Symbol Pde10a
Ensembl Gene ENSMUSG00000023868
Gene Namephosphodiesterase 10A
Synonyms
MMRRC Submission 038310-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0015 (G1)
Quality Score86
Status Validated
Chromosome17
Chromosomal Location8525372-8986648 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8977197 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 640 (D640G)
Ref Sequence ENSEMBL: ENSMUSP00000111380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024647] [ENSMUST00000089085] [ENSMUST00000115708] [ENSMUST00000115715] [ENSMUST00000115717] [ENSMUST00000115720] [ENSMUST00000115724] [ENSMUST00000149440] [ENSMUST00000231430]
Predicted Effect probably damaging
Transcript: ENSMUST00000024647
AA Change: D640G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024647
Gene: ENSMUSG00000023868
AA Change: D640G

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000089085
AA Change: D720G

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000086485
Gene: ENSMUSG00000023868
AA Change: D720G

DomainStartEndE-ValueType
GAF 101 254 1.44e-3 SMART
GAF 276 432 6.56e-29 SMART
HDc 522 688 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115708
AA Change: D436G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111373
Gene: ENSMUSG00000023868
AA Change: D436G

DomainStartEndE-ValueType
GAF 3 148 5.22e-23 SMART
HDc 238 404 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115715
AA Change: D640G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111380
Gene: ENSMUSG00000023868
AA Change: D640G

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115717
Predicted Effect possibly damaging
Transcript: ENSMUST00000115720
AA Change: D703G

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111385
Gene: ENSMUSG00000023868
AA Change: D703G

DomainStartEndE-ValueType
GAF 84 237 1.44e-3 SMART
GAF 259 415 6.56e-29 SMART
HDc 505 671 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115724
AA Change: D774G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111389
Gene: ENSMUSG00000023868
AA Change: D774G

DomainStartEndE-ValueType
GAF 95 248 1.44e-3 SMART
GAF 270 426 6.56e-29 SMART
HDc 516 682 9.04e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000149440
AA Change: D651G

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123216
Gene: ENSMUSG00000023868
AA Change: D651G

DomainStartEndE-ValueType
GAF 32 185 1.44e-3 SMART
GAF 207 363 6.56e-29 SMART
HDc 453 619 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000231430
AA Change: D1002G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase family. It plays a role in signal transduction by regulating the intracellular concentration of cyclic nucleotides. This protein can hydrolyze both cAMP and cGMP to the corresponding nucleoside 5' monophosphate, but has higher affinity for cAMP, and is more efficient with cAMP as substrate. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mutation of this gene results in decreased exploratory behavior, hypoactivity, and a delay in the acquisition of conditioned avoidance behavior. A hypomorphic allele results in increased social behavior. Mice homozygous for a knock-out allele exhibit resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,186,184 R408H probably damaging Het
A130050O07Rik A G 1: 137,928,656 Y23C unknown Het
Adcy3 G A 12: 4,195,260 probably null Het
Aldh6a1 G A 12: 84,441,780 L86F probably damaging Het
Arl10 G T 13: 54,575,957 probably benign Het
Armc3 A G 2: 19,296,321 probably null Het
Astn2 T G 4: 66,266,382 probably null Het
Cacna1d G A 14: 30,114,971 T804I probably benign Het
Ccny A C 18: 9,316,682 probably benign Het
Cdh5 C T 8: 104,140,927 T612I probably benign Het
Cfap58 A G 19: 48,029,100 M800V probably benign Het
Clrn1 A T 3: 58,846,427 I171K probably damaging Het
Cnp T A 11: 100,578,908 probably null Het
Col12a1 T C 9: 79,651,385 T1933A probably damaging Het
Cwf19l2 A G 9: 3,454,666 S660G probably benign Het
Dync1i2 C A 2: 71,214,484 R13S probably damaging Het
Eps8l1 A T 7: 4,477,557 probably benign Het
Espn T C 4: 152,139,152 T188A possibly damaging Het
F2 T C 2: 91,630,607 E260G probably benign Het
Fat4 T A 3: 38,982,503 S3435T probably damaging Het
Fchsd1 A G 18: 37,962,959 C533R probably benign Het
Fstl5 G A 3: 76,322,191 V100M probably damaging Het
Gls2 T G 10: 128,209,350 L572R probably damaging Het
Gm20939 A T 17: 94,876,768 E281D probably benign Het
Gpr35 T G 1: 92,983,232 L222W probably damaging Het
Hsf5 C A 11: 87,657,335 H615N probably benign Het
Id2 C T 12: 25,095,803 D70N probably damaging Het
Ints2 T C 11: 86,249,287 T240A probably damaging Het
Kcnn3 A C 3: 89,662,773 D631A probably damaging Het
Klhdc8a A G 1: 132,303,005 T203A probably damaging Het
Lama4 C T 10: 39,075,436 T1059M possibly damaging Het
Lgals8 A G 13: 12,447,298 L226P probably damaging Het
Lifr T A 15: 7,188,186 probably null Het
Lonp1 T A 17: 56,618,406 Q462L probably benign Het
Lypd1 A G 1: 125,910,438 V48A possibly damaging Het
Mapkapk2 A G 1: 131,097,326 I67T possibly damaging Het
Mbd3l1 A T 9: 18,484,858 D93V probably benign Het
Mdh1b T C 1: 63,721,800 probably benign Het
Myh7b C T 2: 155,622,286 P569L probably damaging Het
Ncapd3 C A 9: 27,051,809 A470E probably damaging Het
Ndrg2 A G 14: 51,910,445 probably benign Het
Nprl2 A T 9: 107,544,419 I209F probably damaging Het
Ntrk1 A G 3: 87,791,750 probably benign Het
Olfm2 T C 9: 20,668,741 E268G probably damaging Het
Olfr884 T A 9: 38,047,667 Y148* probably null Het
Pcf11 T A 7: 92,658,317 H881L probably benign Het
Pde9a G A 17: 31,386,356 probably null Het
Pianp G T 6: 125,001,540 G236V probably damaging Het
Polr2g A G 19: 8,793,652 I160T probably damaging Het
Ppp1r3a A G 6: 14,717,661 S1085P possibly damaging Het
Pter G A 2: 13,001,000 G328D probably damaging Het
Rad51 T A 2: 119,116,327 M5K probably benign Het
Rbm43 T A 2: 51,925,667 I181F probably benign Het
Rgs12 T C 5: 35,022,776 probably benign Het
Rnf213 A C 11: 119,441,606 D2547A possibly damaging Het
Slc20a2 C A 8: 22,535,345 A21E probably damaging Het
Stab2 A G 10: 86,843,617 S2503P probably benign Het
Sv2b A T 7: 75,125,641 F479L probably damaging Het
Sybu T C 15: 44,673,500 R349G probably damaging Het
Tead3 T C 17: 28,341,351 Y2C probably damaging Het
Tnrc6c T A 11: 117,721,458 N307K probably damaging Het
Ubxn11 C G 4: 134,116,025 probably null Het
Ust T C 10: 8,330,065 probably benign Het
Vmn2r116 T A 17: 23,401,849 N852K probably benign Het
Zgrf1 T C 3: 127,555,397 probably benign Het
Other mutations in Pde10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Pde10a APN 17 8944970 missense probably damaging 1.00
IGL01762:Pde10a APN 17 8942918 missense possibly damaging 0.74
IGL01814:Pde10a APN 17 8929107 start codon destroyed probably null 0.00
IGL02053:Pde10a APN 17 8974769 missense probably damaging 1.00
IGL02386:Pde10a APN 17 8953804 missense possibly damaging 0.93
IGL02573:Pde10a APN 17 8961890 missense probably benign 0.38
IGL02583:Pde10a APN 17 8981630 missense probably benign 0.23
IGL02649:Pde10a APN 17 8953772 missense probably damaging 1.00
IGL02992:Pde10a APN 17 8949461 missense probably damaging 0.97
IGL03109:Pde10a APN 17 8929214 critical splice donor site probably null
buzzed UTSW 17 8930537 missense probably damaging 1.00
thunderball UTSW 17 8969589 missense probably damaging 1.00
R0004:Pde10a UTSW 17 8981576 missense probably benign 0.00
R0015:Pde10a UTSW 17 8977197 missense probably damaging 1.00
R0650:Pde10a UTSW 17 8942965 missense probably damaging 1.00
R1173:Pde10a UTSW 17 8920546 splice site probably benign
R1386:Pde10a UTSW 17 8953742 missense probably damaging 1.00
R1458:Pde10a UTSW 17 8964708 missense probably damaging 0.98
R1598:Pde10a UTSW 17 8929144 missense probably damaging 1.00
R1661:Pde10a UTSW 17 8898870 missense probably damaging 1.00
R1665:Pde10a UTSW 17 8898870 missense probably damaging 1.00
R1883:Pde10a UTSW 17 8978944 missense possibly damaging 0.86
R1960:Pde10a UTSW 17 8942918 missense possibly damaging 0.74
R2005:Pde10a UTSW 17 8929091 critical splice acceptor site probably null
R2071:Pde10a UTSW 17 8961995 missense probably benign 0.22
R2121:Pde10a UTSW 17 8977215 missense probably damaging 1.00
R2376:Pde10a UTSW 17 8930537 missense probably damaging 1.00
R3721:Pde10a UTSW 17 8969589 missense probably damaging 1.00
R3872:Pde10a UTSW 17 8757091 missense possibly damaging 0.92
R4627:Pde10a UTSW 17 8981652 missense probably damaging 1.00
R4652:Pde10a UTSW 17 8757053 missense possibly damaging 0.82
R5107:Pde10a UTSW 17 8944970 missense probably damaging 1.00
R5184:Pde10a UTSW 17 8977155 missense probably damaging 1.00
R5354:Pde10a UTSW 17 8961980 missense probably damaging 0.97
R5735:Pde10a UTSW 17 8941192 missense probably damaging 0.99
R5878:Pde10a UTSW 17 8949372 missense possibly damaging 0.85
R5921:Pde10a UTSW 17 8930537 missense probably damaging 1.00
R6027:Pde10a UTSW 17 8964677 missense possibly damaging 0.78
R6145:Pde10a UTSW 17 8929117 missense probably damaging 1.00
R6279:Pde10a UTSW 17 8978957 missense probably damaging 0.99
R6409:Pde10a UTSW 17 8949438 missense probably damaging 1.00
R6870:Pde10a UTSW 17 8967524 missense possibly damaging 0.56
R6947:Pde10a UTSW 17 8969592 missense probably damaging 1.00
R7072:Pde10a UTSW 17 8943026 missense probably benign 0.40
R7084:Pde10a UTSW 17 8941162 missense probably benign 0.25
R7294:Pde10a UTSW 17 8757021 missense probably benign
R7339:Pde10a UTSW 17 8757028 missense probably benign 0.01
R7347:Pde10a UTSW 17 8967462 missense probably damaging 1.00
R7373:Pde10a UTSW 17 8942992 missense probably benign 0.00
R7481:Pde10a UTSW 17 8949430 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- AACACAGTGCCAGACGGTGATG -3'
(R):5'- GCTACAACACAGAGTAGGCTGGAC -3'

Sequencing Primer
(F):5'- AGAGACTGCCATTGCTTTGAC -3'
(R):5'- CACAGAGTAGGCTGGACACTTG -3'
Posted On2013-08-06