Incidental Mutation 'R0018:Dse'
ID64944
Institutional Source Beutler Lab
Gene Symbol Dse
Ensembl Gene ENSMUSG00000039497
Gene Namedermatan sulfate epimerase
SynonymsSart2, DS-epi1, B130024B19Rik
MMRRC Submission 038313-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.534) question?
Stock #R0018 (G1)
Quality Score95
Status Validated
Chromosome10
Chromosomal Location34151393-34207715 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34153468 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 542 (V542A)
Ref Sequence ENSEMBL: ENSMUSP00000040074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048010] [ENSMUST00000217051]
Predicted Effect probably benign
Transcript: ENSMUST00000048010
AA Change: V542A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000040074
Gene: ENSMUSG00000039497
AA Change: V542A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF4962 24 353 5.2e-11 PFAM
low complexity region 558 568 N/A INTRINSIC
low complexity region 797 815 N/A INTRINSIC
transmembrane domain 901 923 N/A INTRINSIC
transmembrane domain 935 952 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216774
Predicted Effect probably benign
Transcript: ENSMUST00000217051
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tumor-rejection antigen. It is localized to the endoplasmic reticulum and functions to convert D-glucuronic acid to L-iduronic acid during the biosynthesis of dermatan sulfate. This antigen possesses tumor epitopes capable of inducing HLA-A24-restricted and tumor-specific cytotoxic T lymphocytes in cancer patients and may be useful for specific immunotherapy. Mutations in this gene cause inmusculocontractural Ehlers-Danlos syndrome. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 9, and a paralogous gene exists on chromosome 18. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and length with altered skin morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T A 1: 93,154,605 D264V probably benign Het
Abca17 T C 17: 24,313,188 probably null Het
Afp A C 5: 90,506,741 Q546P probably damaging Het
Api5 A T 2: 94,420,984 probably null Het
Atp2b4 T A 1: 133,717,871 I982F probably damaging Het
BC024139 G A 15: 76,120,887 Q592* probably null Het
Capn7 T A 14: 31,354,112 C290* probably null Het
Celsr1 T A 15: 86,031,042 D910V possibly damaging Het
Chga T C 12: 102,558,505 S45P probably damaging Het
Cpne2 T A 8: 94,556,053 C59S possibly damaging Het
Cyp2b13 G A 7: 26,085,950 R248H probably benign Het
Cyr61 A G 3: 145,649,431 L23P probably damaging Het
Dennd1a T A 2: 37,858,460 T336S possibly damaging Het
Drc7 A G 8: 95,074,234 Y628C probably damaging Het
Dspp A T 5: 104,178,230 S820C unknown Het
Eif5b T C 1: 38,018,889 S91P unknown Het
Epop A G 11: 97,628,191 V364A probably benign Het
Ext2 G A 2: 93,795,692 P341L probably damaging Het
Galns T C 8: 122,584,985 T429A probably benign Het
Gm11639 G A 11: 104,721,552 probably null Het
Gsx2 A G 5: 75,077,167 K260R probably damaging Het
H2-M10.6 A C 17: 36,814,049 H286P probably damaging Het
Hectd4 A G 5: 121,254,179 N169D possibly damaging Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Hmcn1 T C 1: 150,652,551 D3282G probably benign Het
Hnmt T A 2: 24,003,628 N285Y possibly damaging Het
Hr A G 14: 70,558,277 R450G probably benign Het
Kat6a A G 8: 22,929,273 D684G possibly damaging Het
Kif27 T G 13: 58,288,053 I1309L probably benign Het
Man2b1 T A 8: 85,097,489 V1005E probably damaging Het
Me2 A T 18: 73,791,852 F265I possibly damaging Het
Myo9a A T 9: 59,871,724 T1588S probably benign Het
Neu4 T A 1: 94,025,338 D476E probably benign Het
Nlrp9c T A 7: 26,371,998 Q895L possibly damaging Het
Olfr395 T C 11: 73,906,626 I289V probably damaging Het
Olfr406 A C 11: 74,270,108 T240P probably benign Het
Pdzd8 C T 19: 59,300,673 R765H probably damaging Het
Plk1 T C 7: 122,168,985 probably null Het
Ppfia2 A G 10: 106,842,786 probably benign Het
Prkdc T C 16: 15,726,542 Y1799H probably benign Het
Psmc1 T C 12: 100,116,692 probably benign Het
Ptchd3 A C 11: 121,842,344 I687L probably benign Het
Ptprh A G 7: 4,601,846 probably null Het
Pus3 A G 9: 35,566,624 D384G probably benign Het
Rab44 C T 17: 29,139,380 P181S probably benign Het
Rasa2 A G 9: 96,571,963 S307P probably damaging Het
Rbpms2 A G 9: 65,651,078 D142G probably damaging Het
Reln A T 5: 21,925,371 D2647E probably benign Het
Ryr2 G A 13: 11,595,223 T4239I possibly damaging Het
Sctr C A 1: 120,043,556 probably benign Het
Serpinb6e A T 13: 33,837,845 Y167N probably damaging Het
Slc13a5 T C 11: 72,266,475 I31V probably benign Het
Slc15a4 A T 5: 127,602,010 I422N probably damaging Het
Stk24 G A 14: 121,308,007 probably benign Het
Vmn1r213 T A 13: 23,012,141 V298D probably damaging Het
Xdh C T 17: 73,925,025 R230H probably benign Het
Zfp418 A T 7: 7,182,450 S471C probably benign Het
Other mutations in Dse
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Dse APN 10 34162805 missense probably damaging 1.00
IGL01828:Dse APN 10 34152776 missense probably damaging 0.97
IGL01835:Dse APN 10 34160217 splice site probably benign
IGL01942:Dse APN 10 34155993 missense probably benign 0.02
IGL02047:Dse APN 10 34162845 nonsense probably null
IGL02208:Dse APN 10 34152437 missense probably benign
IGL02306:Dse APN 10 34160134 missense probably damaging 0.96
IGL02504:Dse APN 10 34152800 missense probably benign
IGL02626:Dse APN 10 34153162 missense probably damaging 0.99
IGL02812:Dse APN 10 34183716 missense probably damaging 1.00
R0018:Dse UTSW 10 34153468 missense probably benign 0.00
R0131:Dse UTSW 10 34153664 missense probably damaging 1.00
R1300:Dse UTSW 10 34152415 missense probably benign 0.00
R1502:Dse UTSW 10 34153218 missense probably damaging 1.00
R1619:Dse UTSW 10 34153234 missense probably damaging 1.00
R1736:Dse UTSW 10 34153149 missense probably damaging 1.00
R1857:Dse UTSW 10 34153229 missense probably benign 0.03
R1858:Dse UTSW 10 34153229 missense probably benign 0.03
R1859:Dse UTSW 10 34153229 missense probably benign 0.03
R1868:Dse UTSW 10 34153288 missense possibly damaging 0.86
R1959:Dse UTSW 10 34160206 missense probably damaging 1.00
R2082:Dse UTSW 10 34155940 missense probably damaging 1.00
R2325:Dse UTSW 10 34184047 missense probably benign 0.23
R2883:Dse UTSW 10 34152507 missense probably benign 0.34
R3436:Dse UTSW 10 34152474 missense probably benign
R3818:Dse UTSW 10 34153433 missense probably benign
R4158:Dse UTSW 10 34153334 missense probably damaging 1.00
R4159:Dse UTSW 10 34153334 missense probably damaging 1.00
R4160:Dse UTSW 10 34153334 missense probably damaging 1.00
R4229:Dse UTSW 10 34162744 missense probably damaging 1.00
R4414:Dse UTSW 10 34152636 missense probably benign 0.04
R4667:Dse UTSW 10 34153012 missense probably damaging 1.00
R4669:Dse UTSW 10 34153012 missense probably damaging 1.00
R4777:Dse UTSW 10 34153588 missense possibly damaging 0.56
R5154:Dse UTSW 10 34153661 missense possibly damaging 0.83
R5573:Dse UTSW 10 34152682 missense probably benign 0.02
R5804:Dse UTSW 10 34153379 missense possibly damaging 0.84
R5844:Dse UTSW 10 34153042 missense probably damaging 0.99
R5895:Dse UTSW 10 34152605 missense probably damaging 1.00
R6290:Dse UTSW 10 34152340 missense probably benign 0.00
R6600:Dse UTSW 10 34152541 missense probably benign 0.06
R7088:Dse UTSW 10 34153889 missense probably damaging 1.00
R7254:Dse UTSW 10 34184148 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CCGAGGATACATCACTGAGGCAAAG -3'
(R):5'- AATGCAGGACATGAGCACCCTGAC -3'

Sequencing Primer
(F):5'- TATAGAGACCGTCTCGCTGC -3'
(R):5'- TGTATGGGCCAAAGTACACC -3'
Posted On2013-08-06