Incidental Mutation 'R0018:Psmc1'
ID64949
Institutional Source Beutler Lab
Gene Symbol Psmc1
Ensembl Gene ENSMUSG00000021178
Gene Nameprotease (prosome, macropain) 26S subunit, ATPase 1
SynonymsS4, Rpt2/S4, rpt2, P26s4
MMRRC Submission 038313-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0018 (G1)
Quality Score95
Status Validated
Chromosome12
Chromosomal Location100110154-100123405 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 100116692 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021595]
Predicted Effect probably benign
Transcript: ENSMUST00000021595
SMART Domains Protein: ENSMUSP00000021595
Gene: ENSMUSG00000021178

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
low complexity region 27 43 N/A INTRINSIC
AAA 218 357 1.57e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223078
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. This subunit and a 20S core alpha subunit interact specifically with the hepatitis B virus X protein, a protein critical to viral replication. This subunit also interacts with the adenovirus E1A protein and this interaction alters the activity of the proteasome. Finally, this subunit interacts with ataxin-7, suggesting a role for the proteasome in the development of spinocerebellar ataxia type 7, a progressive neurodegenerative disorder. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are embryonic lethal. Conditional null in cortical neurons causes neurodegeneration and premature death in several different models. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T A 1: 93,154,605 D264V probably benign Het
Abca17 T C 17: 24,313,188 probably null Het
Afp A C 5: 90,506,741 Q546P probably damaging Het
Api5 A T 2: 94,420,984 probably null Het
Atp2b4 T A 1: 133,717,871 I982F probably damaging Het
BC024139 G A 15: 76,120,887 Q592* probably null Het
Capn7 T A 14: 31,354,112 C290* probably null Het
Celsr1 T A 15: 86,031,042 D910V possibly damaging Het
Chga T C 12: 102,558,505 S45P probably damaging Het
Cpne2 T A 8: 94,556,053 C59S possibly damaging Het
Cyp2b13 G A 7: 26,085,950 R248H probably benign Het
Cyr61 A G 3: 145,649,431 L23P probably damaging Het
Dennd1a T A 2: 37,858,460 T336S possibly damaging Het
Drc7 A G 8: 95,074,234 Y628C probably damaging Het
Dse A G 10: 34,153,468 V542A probably benign Het
Dspp A T 5: 104,178,230 S820C unknown Het
Eif5b T C 1: 38,018,889 S91P unknown Het
Epop A G 11: 97,628,191 V364A probably benign Het
Ext2 G A 2: 93,795,692 P341L probably damaging Het
Galns T C 8: 122,584,985 T429A probably benign Het
Gm11639 G A 11: 104,721,552 probably null Het
Gsx2 A G 5: 75,077,167 K260R probably damaging Het
H2-M10.6 A C 17: 36,814,049 H286P probably damaging Het
Hectd4 A G 5: 121,254,179 N169D possibly damaging Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Hmcn1 T C 1: 150,652,551 D3282G probably benign Het
Hnmt T A 2: 24,003,628 N285Y possibly damaging Het
Hr A G 14: 70,558,277 R450G probably benign Het
Kat6a A G 8: 22,929,273 D684G possibly damaging Het
Kif27 T G 13: 58,288,053 I1309L probably benign Het
Man2b1 T A 8: 85,097,489 V1005E probably damaging Het
Me2 A T 18: 73,791,852 F265I possibly damaging Het
Myo9a A T 9: 59,871,724 T1588S probably benign Het
Neu4 T A 1: 94,025,338 D476E probably benign Het
Nlrp9c T A 7: 26,371,998 Q895L possibly damaging Het
Olfr395 T C 11: 73,906,626 I289V probably damaging Het
Olfr406 A C 11: 74,270,108 T240P probably benign Het
Pdzd8 C T 19: 59,300,673 R765H probably damaging Het
Plk1 T C 7: 122,168,985 probably null Het
Ppfia2 A G 10: 106,842,786 probably benign Het
Prkdc T C 16: 15,726,542 Y1799H probably benign Het
Ptchd3 A C 11: 121,842,344 I687L probably benign Het
Ptprh A G 7: 4,601,846 probably null Het
Pus3 A G 9: 35,566,624 D384G probably benign Het
Rab44 C T 17: 29,139,380 P181S probably benign Het
Rasa2 A G 9: 96,571,963 S307P probably damaging Het
Rbpms2 A G 9: 65,651,078 D142G probably damaging Het
Reln A T 5: 21,925,371 D2647E probably benign Het
Ryr2 G A 13: 11,595,223 T4239I possibly damaging Het
Sctr C A 1: 120,043,556 probably benign Het
Serpinb6e A T 13: 33,837,845 Y167N probably damaging Het
Slc13a5 T C 11: 72,266,475 I31V probably benign Het
Slc15a4 A T 5: 127,602,010 I422N probably damaging Het
Stk24 G A 14: 121,308,007 probably benign Het
Vmn1r213 T A 13: 23,012,141 V298D probably damaging Het
Xdh C T 17: 73,925,025 R230H probably benign Het
Zfp418 A T 7: 7,182,450 S471C probably benign Het
Other mutations in Psmc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01700:Psmc1 APN 12 100113078 missense probably damaging 1.00
IGL02445:Psmc1 APN 12 100114828 splice site probably benign
IGL02605:Psmc1 APN 12 100119127 missense probably damaging 1.00
R0018:Psmc1 UTSW 12 100116692 splice site probably benign
R0427:Psmc1 UTSW 12 100119228 missense probably damaging 0.96
R0534:Psmc1 UTSW 12 100120130 missense possibly damaging 0.79
R0931:Psmc1 UTSW 12 100119082 missense probably damaging 0.99
R1937:Psmc1 UTSW 12 100114843 missense probably benign 0.26
R2405:Psmc1 UTSW 12 100120103 missense probably benign 0.03
R5063:Psmc1 UTSW 12 100115475 missense probably damaging 0.97
R5293:Psmc1 UTSW 12 100115472 missense probably benign 0.11
R5346:Psmc1 UTSW 12 100120100 missense probably damaging 0.99
R5542:Psmc1 UTSW 12 100120140 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGAAAACTCAGTGAGACACCTGCC -3'
(R):5'- GCCTGCTAAGCAGTGTGTTCTACC -3'

Sequencing Primer
(F):5'- GAGACACCTGCCCTCTTCAG -3'
(R):5'- CCAGCTCCAGAGTTGAGCTAAG -3'
Posted On2013-08-06