Incidental Mutation 'R0344:Topbp1'
Institutional Source Beutler Lab
Gene Symbol Topbp1
Ensembl Gene ENSMUSG00000032555
Gene Nametopoisomerase (DNA) II binding protein 1
SynonymsD430026L04Rik, 2810429C13Rik, 1110031N14Rik
MMRRC Submission 038551-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0344 (G1)
Quality Score141
Status Validated
Chromosomal Location103305215-103350428 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 103308733 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035164] [ENSMUST00000142540] [ENSMUST00000187065]
Predicted Effect probably benign
Transcript: ENSMUST00000035164
SMART Domains Protein: ENSMUSP00000035164
Gene: ENSMUSG00000032555

BRCT 6 91 3.04e1 SMART
BRCT 103 179 1.51e-13 SMART
BRCT 197 274 4.69e-19 SMART
BRCT 355 433 3.58e-15 SMART
BRCT 553 626 5.57e-3 SMART
BRCT 646 731 1.53e-9 SMART
BRCT 904 983 3.48e-13 SMART
low complexity region 1097 1106 N/A INTRINSIC
low complexity region 1110 1121 N/A INTRINSIC
low complexity region 1213 1218 N/A INTRINSIC
BRCT 1258 1337 2.31e-9 SMART
Blast:BRCT 1387 1472 4e-52 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000142540
Predicted Effect probably benign
Transcript: ENSMUST00000187065
SMART Domains Protein: ENSMUSP00000139773
Gene: ENSMUSG00000032555

PDB:2XNH|A 1 130 2e-81 PDB
Blast:BRCT 6 91 8e-58 BLAST
Blast:BRCT 103 130 2e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189631
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.3%
  • 20x: 93.6%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a binding protein which interacts with the C-terminal region of topoisomerase II beta. This interaction suggests a supportive role for this protein in the catalytic reactions of topoisomerase II beta through transient breakages of DNA strands. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die around implantation due to embryonic growth arrest, increased apoptosis, and decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553J12Rik T A 16: 88,820,301 C29* probably null Het
Abca4 G A 3: 122,083,964 C324Y probably damaging Het
Ablim2 T G 5: 35,836,933 probably benign Het
Abr A T 11: 76,479,044 V115E probably damaging Het
Adgrl2 C T 3: 148,865,595 probably null Het
Aff3 A T 1: 38,203,932 S936T probably benign Het
Agap3 T C 5: 24,451,202 probably benign Het
Ahrr T A 13: 74,214,586 S393C probably damaging Het
Amfr T C 8: 93,987,370 probably null Het
Ankrd26 C A 6: 118,507,637 probably null Het
Asxl3 G A 18: 22,517,611 V886I probably benign Het
Atp5a1 C A 18: 77,780,195 N356K probably damaging Het
Atp5s T C 12: 69,740,889 probably benign Het
AU021092 A T 16: 5,222,167 M31K possibly damaging Het
Bicral A G 17: 46,814,052 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
C3ar1 T C 6: 122,850,772 D162G probably benign Het
Camkk2 C T 5: 122,763,877 C123Y probably benign Het
Casp8ap2 A T 4: 32,644,079 I1051F probably damaging Het
Catsperg1 A T 7: 29,195,540 V544E probably damaging Het
Cdc27 G A 11: 104,526,991 probably benign Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Dennd6b T C 15: 89,196,229 Q56R probably benign Het
Fbxl17 G A 17: 63,385,067 probably benign Het
Fubp1 T C 3: 152,219,713 V164A probably damaging Het
Gdap2 G A 3: 100,178,256 G165S probably damaging Het
Gm13084 A T 4: 143,810,768 I331N probably damaging Het
Gns A G 10: 121,383,423 K352E probably benign Het
Gtf2ird2 C T 5: 134,191,249 T22M probably damaging Het
Herc3 A G 6: 58,868,628 probably benign Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Inpp1 A T 1: 52,799,354 F45L probably damaging Het
Ipo4 T C 14: 55,625,942 Q1073R possibly damaging Het
Itgae A G 11: 73,118,147 K485E probably benign Het
Jak2 G A 19: 29,283,629 V342I probably damaging Het
Kptn C A 7: 16,125,741 Q297K probably damaging Het
Lims2 A G 18: 31,944,520 E103G probably benign Het
Mthfr C G 4: 148,055,428 S618W probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nup133 A G 8: 123,917,446 V727A possibly damaging Het
Oas2 T G 5: 120,743,087 E313A probably damaging Het
Olfr1031 T A 2: 85,992,382 C188* probably null Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr487 A T 7: 108,211,742 Y262* probably null Het
Olfr691 C A 7: 105,337,607 M36I probably benign Het
Olfr961 G A 9: 39,647,350 C208Y probably damaging Het
Park7 A G 4: 150,908,349 V20A possibly damaging Het
Phldb1 C A 9: 44,701,667 V919L probably benign Het
Pkhd1l1 C A 15: 44,597,011 H4205Q probably benign Het
Plekhg3 G T 12: 76,566,266 E449* probably null Het
Pstpip1 T C 9: 56,126,645 V301A probably benign Het
Ptdss1 G A 13: 66,933,572 R22H probably damaging Het
Ptprq A G 10: 107,705,582 V361A probably benign Het
Ralgapa2 A T 2: 146,346,794 V1309E possibly damaging Het
Rere T C 4: 150,610,981 probably benign Het
Sbk3 T A 7: 4,967,405 T322S possibly damaging Het
Scn9a T A 2: 66,505,010 I1203L probably damaging Het
Setdb1 A T 3: 95,326,131 probably benign Het
Sik3 C A 9: 46,208,811 Q683K probably damaging Het
Slc24a5 A G 2: 125,085,701 I307V probably benign Het
Smg6 A G 11: 74,929,821 D306G probably damaging Het
Snx13 G A 12: 35,086,900 W120* probably null Het
Snx5 A G 2: 144,257,208 probably benign Het
Srsf5 T C 12: 80,947,524 S76P probably benign Het
Stard6 A G 18: 70,496,115 D31G probably damaging Het
Taf3 A G 2: 9,951,898 M333T probably benign Het
Taf6 T G 5: 138,181,147 I377L probably benign Het
Taf8 G T 17: 47,493,580 N252K probably benign Het
Tfap2c A G 2: 172,551,503 T113A probably benign Het
Tmem246 T C 4: 49,586,566 T201A probably benign Het
Tmtc4 C T 14: 122,978,160 V25M probably damaging Het
Ttn A T 2: 76,712,489 D33384E probably damaging Het
Unc13c T C 9: 73,930,785 E928G probably benign Het
Vav1 T C 17: 57,296,090 F81L probably damaging Het
Vmn2r63 A G 7: 42,903,618 I738T probably damaging Het
Vmn2r87 C T 10: 130,479,937 E87K probably damaging Het
Zfp229 A T 17: 21,745,841 M351L probably benign Het
Other mutations in Topbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Topbp1 APN 9 103344943 missense probably benign
IGL01524:Topbp1 APN 9 103311645 missense possibly damaging 0.92
IGL02335:Topbp1 APN 9 103328523 missense probably damaging 1.00
IGL02441:Topbp1 APN 9 103320239 missense possibly damaging 0.49
IGL02943:Topbp1 APN 9 103328440 missense probably benign 0.00
IGL02953:Topbp1 APN 9 103328435 missense probably benign 0.26
IGL03040:Topbp1 APN 9 103328667 missense possibly damaging 0.51
PIT4377001:Topbp1 UTSW 9 103309889 missense possibly damaging 0.90
R0044:Topbp1 UTSW 9 103325773 missense possibly damaging 0.94
R0344:Topbp1 UTSW 9 103328687 missense probably damaging 0.99
R0591:Topbp1 UTSW 9 103349838 missense probably benign 0.01
R0666:Topbp1 UTSW 9 103308812 missense probably benign
R0785:Topbp1 UTSW 9 103315090 missense probably damaging 1.00
R0906:Topbp1 UTSW 9 103328593 missense probably benign 0.00
R1352:Topbp1 UTSW 9 103347008 missense probably benign
R1745:Topbp1 UTSW 9 103308845 missense probably benign 0.36
R2104:Topbp1 UTSW 9 103317982 splice site probably benign
R2166:Topbp1 UTSW 9 103312929 unclassified probably null
R2230:Topbp1 UTSW 9 103345848 missense probably damaging 1.00
R2967:Topbp1 UTSW 9 103342140 missense probably benign 0.01
R3845:Topbp1 UTSW 9 103309923 missense possibly damaging 0.87
R4089:Topbp1 UTSW 9 103324501 critical splice donor site probably null
R4110:Topbp1 UTSW 9 103309959 missense probably damaging 0.98
R4454:Topbp1 UTSW 9 103344871 missense probably damaging 1.00
R4521:Topbp1 UTSW 9 103334202 intron probably benign
R4745:Topbp1 UTSW 9 103323571 missense probably damaging 1.00
R4923:Topbp1 UTSW 9 103312836 missense probably benign 0.00
R4934:Topbp1 UTSW 9 103328369 unclassified probably benign
R4963:Topbp1 UTSW 9 103320605 missense probably benign 0.04
R5199:Topbp1 UTSW 9 103346672 unclassified probably benign
R5461:Topbp1 UTSW 9 103315196 missense probably benign 0.00
R5517:Topbp1 UTSW 9 103336114 missense probably benign 0.03
R5563:Topbp1 UTSW 9 103311513 missense possibly damaging 0.46
R5564:Topbp1 UTSW 9 103334078 missense probably damaging 1.00
R5683:Topbp1 UTSW 9 103312804 missense possibly damaging 0.93
R5774:Topbp1 UTSW 9 103328499 missense probably benign 0.06
R5785:Topbp1 UTSW 9 103323528 missense probably benign 0.00
R6029:Topbp1 UTSW 9 103344953 missense probably benign 0.00
R6077:Topbp1 UTSW 9 103332990 missense probably damaging 1.00
R6122:Topbp1 UTSW 9 103346961 missense probably benign 0.06
R6133:Topbp1 UTSW 9 103311764 unclassified probably null
R6213:Topbp1 UTSW 9 103332751 missense probably benign 0.12
R6773:Topbp1 UTSW 9 103343692 missense possibly damaging 0.90
R6922:Topbp1 UTSW 9 103335846 missense probably damaging 1.00
R6938:Topbp1 UTSW 9 103328554 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- acacacacacagacagacag -3'
Posted On2013-08-08