Incidental Mutation 'R0335:Prkar2a'
ID65211
Institutional Source Beutler Lab
Gene Symbol Prkar2a
Ensembl Gene ENSMUSG00000032601
Gene Nameprotein kinase, cAMP dependent regulatory, type II alpha
Synonyms1110061A24Rik, RII(alpha)
MMRRC Submission 038544-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0335 (G1)
Quality Score120
Status Validated
Chromosome9
Chromosomal Location108689314-108750436 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108719258 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 134 (D134V)
Ref Sequence ENSEMBL: ENSMUSP00000035220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035220] [ENSMUST00000192344] [ENSMUST00000195405]
Predicted Effect probably damaging
Transcript: ENSMUST00000035220
AA Change: D134V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035220
Gene: ENSMUSG00000032601
AA Change: D134V

DomainStartEndE-ValueType
RIIa 8 45 7.15e-16 SMART
low complexity region 70 85 N/A INTRINSIC
low complexity region 104 114 N/A INTRINSIC
cNMP 137 257 2.27e-23 SMART
cNMP 259 384 2.02e-29 SMART
Predicted Effect unknown
Transcript: ENSMUST00000192068
AA Change: D33V
Predicted Effect unknown
Transcript: ENSMUST00000192344
AA Change: I29L
Predicted Effect possibly damaging
Transcript: ENSMUST00000195405
AA Change: D134V

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141869
Gene: ENSMUSG00000032601
AA Change: D134V

DomainStartEndE-ValueType
RIIa 8 45 4.3e-18 SMART
low complexity region 70 85 N/A INTRINSIC
low complexity region 104 114 N/A INTRINSIC
cNMP 137 257 1.1e-25 SMART
cNMP 259 362 3.9e-12 SMART
Meta Mutation Damage Score 0.29 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.6%
  • 20x: 87.5%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. The protein encoded by this gene is one of the regulatory subunits. This subunit can be phosphorylated by the activated catalytic subunit. It may interact with various A-kinase anchoring proteins and determine the subcellular localization of cAMP-dependent protein kinase. This subunit has been shown to regulate protein transport from endosomes to the Golgi apparatus and further to the endoplasmic reticulum (ER). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and appear healthy. They have normal growth and no deficits in locomotor activity, muscle strength, or exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830406C13Rik A G 14: 12,301,266 E124G possibly damaging Het
4932438A13Rik T C 3: 36,969,152 V2210A probably damaging Het
Adamts12 G T 15: 11,311,058 D1134Y possibly damaging Het
Add3 A G 19: 53,236,828 T460A probably benign Het
Amer3 A C 1: 34,579,300 probably benign Het
Arhgap22 C T 14: 33,359,108 probably benign Het
Arhgap32 T G 9: 32,259,760 S1279A probably benign Het
Bcas1 G A 2: 170,418,681 T26M probably damaging Het
Begain A T 12: 109,038,934 F256I probably damaging Het
Cabin1 A T 10: 75,657,049 I1804N probably damaging Het
Cad G A 5: 31,073,985 probably benign Het
Carmil1 G A 13: 24,073,983 S762L probably damaging Het
Ccdc93 T A 1: 121,492,977 L529Q probably damaging Het
Cdh12 T A 15: 21,578,549 probably null Het
Clip2 T A 5: 134,535,215 probably benign Het
Cmip T C 8: 117,445,366 I480T probably damaging Het
Cnot1 A T 8: 95,772,000 I203K probably benign Het
Col18a1 G A 10: 77,059,363 P1155S probably damaging Het
Col1a2 T A 6: 4,531,956 probably benign Het
Crybg3 A T 16: 59,544,140 L2373Q probably damaging Het
D130043K22Rik A T 13: 24,887,877 I935F probably damaging Het
Dapl1 T A 2: 59,496,594 D61E possibly damaging Het
Def6 A G 17: 28,228,069 D558G possibly damaging Het
Dnah6 T C 6: 73,069,399 probably benign Het
Dvl2 G A 11: 70,001,035 probably benign Het
Ecd A C 14: 20,320,734 V639G probably benign Het
Epg5 C T 18: 77,986,472 T1350M probably benign Het
Erbb4 C A 1: 68,259,259 M657I probably benign Het
Evi5 T C 5: 107,812,411 R431G probably benign Het
Fbxo11 G A 17: 88,015,613 A115V possibly damaging Het
Fgfr2 T C 7: 130,196,249 T192A probably benign Het
Gas7 C T 11: 67,662,052 A146V possibly damaging Het
Gatad2b T A 3: 90,356,182 S529T probably benign Het
Gm10722 G T 9: 3,001,048 Q41H probably null Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm7535 A G 17: 17,911,112 probably benign Het
Gstm1 T A 3: 108,012,696 N193I possibly damaging Het
Heatr5b G A 17: 78,827,946 P252L probably benign Het
Hmgb1 A G 5: 149,050,631 V36A probably benign Het
Hrh1 G T 6: 114,480,232 W158L probably damaging Het
Ighv6-4 T C 12: 114,406,674 M53V probably benign Het
Iqgap2 T A 13: 95,635,633 D1346V probably damaging Het
Kcng3 A T 17: 83,587,737 N433K possibly damaging Het
Kif1a T A 1: 93,052,566 probably benign Het
Lctl C A 9: 64,118,887 Q75K probably benign Het
Ldb3 T A 14: 34,578,651 I89F possibly damaging Het
Lrrc49 A T 9: 60,677,095 L156Q probably damaging Het
Mark2 G T 19: 7,281,828 T83K probably benign Het
Ms4a15 A T 19: 10,980,210 D170E probably damaging Het
Msantd2 A G 9: 37,522,760 S99G possibly damaging Het
Nemf G T 12: 69,353,803 T124N probably benign Het
Nlrp9c A T 7: 26,394,136 F35I possibly damaging Het
Nwd2 A G 5: 63,804,773 I567V probably benign Het
Olfr111 A C 17: 37,530,642 I222L probably benign Het
Olfr1340 A G 4: 118,727,170 I308V probably null Het
Olfr323 T C 11: 58,625,740 Y102C probably damaging Het
Olfr828 T A 9: 18,815,994 Q100L probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pdk4 T C 6: 5,491,138 E209G probably benign Het
Plch1 T C 3: 63,710,978 Q712R probably damaging Het
Pnpla1 T A 17: 28,886,878 V569E possibly damaging Het
Ptov1 T A 7: 44,864,622 Q40L possibly damaging Het
Ptprq T C 10: 107,708,728 I314V probably benign Het
Rabl2 T C 15: 89,583,966 K66E probably damaging Het
Rnf38 A G 4: 44,152,507 V19A possibly damaging Het
Scn2a T A 2: 65,682,091 W191R probably damaging Het
Sec22b T A 3: 97,921,256 F212I possibly damaging Het
Sec24c T A 14: 20,688,715 probably null Het
Sept2 T C 1: 93,495,599 S51P probably damaging Het
Serpinb1a T C 13: 32,848,656 N90S probably damaging Het
Slc1a2 C T 2: 102,743,863 T206I probably benign Het
Slc25a19 C A 11: 115,624,206 R42L probably damaging Het
St14 G A 9: 31,091,324 probably benign Het
Stxbp1 C T 2: 32,802,905 probably benign Het
Tas2r131 C T 6: 132,957,829 V6I probably benign Het
Tdo2 T A 3: 81,964,000 M235L probably benign Het
Tenm3 T G 8: 48,232,105 H2432P probably damaging Het
Tmprss15 C T 16: 79,024,742 probably benign Het
Tmx1 A G 12: 70,453,256 N30D probably benign Het
Tom1 A G 8: 75,064,392 probably null Het
Top2a T C 11: 99,022,955 N20S probably benign Het
Ttc23l T A 15: 10,539,963 T145S probably benign Het
Unc13b T A 4: 43,236,983 M3351K possibly damaging Het
Vmn1r47 T C 6: 90,022,659 S258P probably damaging Het
Vmn2r8 T G 5: 108,797,451 probably null Het
Vps11 T C 9: 44,353,838 Q641R probably null Het
Wapl T A 14: 34,692,324 I381N probably damaging Het
Zmym6 G A 4: 127,122,808 G794E probably damaging Het
Other mutations in Prkar2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02064:Prkar2a APN 9 108733204 missense possibly damaging 0.92
IGL02073:Prkar2a APN 9 108733123 missense probably damaging 0.99
IGL02117:Prkar2a APN 9 108719261 missense probably damaging 1.00
IGL02268:Prkar2a APN 9 108746953 missense probably benign 0.04
IGL02635:Prkar2a APN 9 108728277 missense probably damaging 0.99
IGL03006:Prkar2a APN 9 108740441 missense probably benign
R0920:Prkar2a UTSW 9 108719297 splice site probably benign
R0943:Prkar2a UTSW 9 108733276 splice site probably benign
R1513:Prkar2a UTSW 9 108728270 missense possibly damaging 0.82
R2178:Prkar2a UTSW 9 108740538 critical splice donor site probably null
R3820:Prkar2a UTSW 9 108746956 missense probably damaging 1.00
R3842:Prkar2a UTSW 9 108728268 missense probably damaging 1.00
R4807:Prkar2a UTSW 9 108740385 intron probably benign
R4886:Prkar2a UTSW 9 108745624 critical splice donor site probably null
R5051:Prkar2a UTSW 9 108745491 missense probably benign 0.00
R5435:Prkar2a UTSW 9 108740483 missense probably damaging 1.00
R6979:Prkar2a UTSW 9 108733143 missense possibly damaging 0.76
X0060:Prkar2a UTSW 9 108745582 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGCACACTGCTTGCTGTTT -3'
(R):5'- CAGGATCGTGTTACCTTGGCATTTCATA -3'

Sequencing Primer
(F):5'- GCTTGCTGTTTTTGTAGAATTAGAA -3'
(R):5'- agtttgtggctggggtg -3'
Posted On2013-08-08